EMAIL THIS PAGE TO A FRIEND

IFNL2

interferon, lambda 2

38 Gene Product Result for
Synonyms: IL-28A IL28A
UniProtKB ID: Q8IZJ0, Q6VN55, Q8IWL7
Gene ID:
Human(282616) Summary: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28B (IL28B), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
Mouse(330496) interferon lambda 2
naked mole-rat(101699159) interferon, lambda 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195471 MISSION® esiRNA esiRNA targeting mouse Il28a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172138 Rosetta Predictions human pricing
NM_001024673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020860 predicted 211
2 SASI_Hs01_00020861 predicted 225
3 SASI_Hs01_00020862 predicted 202
4 SASI_Hs01_00020863 predicted 223
5 SASI_Hs01_00020865 predicted 226
6 SASI_Hs01_00020866 predicted 398
7 SASI_Hs01_00020867 predicted 448
8 SASI_Hs01_00020868 predicted 377
9 SASI_Hs01_00020869 predicted 226
10 SASI_Hs02_00367850 predicted 371
11 SASI_Hs01_00020864 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126534 predicted 304
2 SASI_Mm02_00287657 predicted 526
3 SASI_Mm02_00287658 predicted 509
4 SASI_Mm01_00126529 predicted 344
5 SASI_Mm01_00126530 predicted 301
6 SASI_Mm01_00126531 predicted 295
7 SASI_Mm01_00126532 predicted 357
8 SASI_Mm01_00126533 predicted 344
9 SASI_Mm01_00126535 predicted 343
10 SASI_Mm01_00126536 predicted 288
11 SASI_Mm01_00126537 predicted 275
12 SASI_Mm01_00126538 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172138
IFNL2 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172138.1-173s21c1
Sequence:CCGGTGCCACATAGCCCAGTTCAAGCTCGAGCTTGAACTGGGCTATGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-218s1c1
Sequence:CCGGGCCTTTAAGAGGGCCAAAGATCTCGAGATCTTTGGCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-442s1c1
Sequence:CCGGGCACCATATCCTCTCCCAGTTCTCGAGAACTGGGAGAGGATATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-227s1c1
Sequence:CCGGAGGGCCAAAGATGCCTTAGAACTCGAGTTCTAAGGCATCTTTGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-580s1c1
Sequence:CCGGCTCTGTCACCTTCAACCTCTTCTCGAGAAGAGGTTGAAGGTGACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-236s1c1
Sequence:CCGGGATGCCTTAGAAGAGTCGCTTCTCGAGAAGCGACTCTTCTAAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172138
IFNL2 MISSION shRNA shRNA Plasmid DNA
interferon, lambda 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172138.1-173s21c1
Sequence:CCGGTGCCACATAGCCCAGTTCAAGCTCGAGCTTGAACTGGGCTATGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-218s1c1
Sequence:CCGGGCCTTTAAGAGGGCCAAAGATCTCGAGATCTTTGGCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-442s1c1
Sequence:CCGGGCACCATATCCTCTCCCAGTTCTCGAGAACTGGGAGAGGATATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-227s1c1
Sequence:CCGGAGGGCCAAAGATGCCTTAGAACTCGAGTTCTAAGGCATCTTTGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-580s1c1
Sequence:CCGGCTCTGTCACCTTCAACCTCTTCTCGAGAAGAGGTTGAAGGTGACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-236s1c1
Sequence:CCGGGATGCCTTAGAAGAGTCGCTTCTCGAGAAGCGACTCTTCTAAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172138
IFNL2 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172138.1-173s21c1
Sequence:CCGGTGCCACATAGCCCAGTTCAAGCTCGAGCTTGAACTGGGCTATGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-218s1c1
Sequence:CCGGGCCTTTAAGAGGGCCAAAGATCTCGAGATCTTTGGCCCTCTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-442s1c1
Sequence:CCGGGCACCATATCCTCTCCCAGTTCTCGAGAACTGGGAGAGGATATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-227s1c1
Sequence:CCGGAGGGCCAAAGATGCCTTAGAACTCGAGTTCTAAGGCATCTTTGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-580s1c1
Sequence:CCGGCTCTGTCACCTTCAACCTCTTCTCGAGAAGAGGTTGAAGGTGACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172138.1-236s1c1
Sequence:CCGGGATGCCTTAGAAGAGTCGCTTCTCGAGAAGCGACTCTTCTAAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024673
IFNL2 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-353s1c1
Sequence:CCGGCTCTTCATACACTGAGCCACACTCGAGTGTGGCTCAGTGTATGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-94s1c1
Sequence:CCGGGCAAAGGATTGCCACATTGCTCTCGAGAGCAATGTGGCAATCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024673
IFNL2 MISSION shRNA shRNA Plasmid DNA
interferon, lambda 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-353s1c1
Sequence:CCGGCTCTTCATACACTGAGCCACACTCGAGTGTGGCTCAGTGTATGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-94s1c1
Sequence:CCGGGCAAAGGATTGCCACATTGCTCTCGAGAGCAATGTGGCAATCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024673
IFNL2 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-353s1c1
Sequence:CCGGCTCTTCATACACTGAGCCACACTCGAGTGTGGCTCAGTGTATGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024673.1-94s1c1
Sequence:CCGGGCAAAGGATTGCCACATTGCTCTCGAGAGCAATGTGGCAATCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)