EMAIL THIS PAGE TO A FRIEND

IFNL3

interferon, lambda 3

48 Gene Product Result for
Synonyms: IL-28B IL28B IL28C
UniProtKB ID: Q8IZI9, A2BDE1, Q6VN56, Q7Z4J3, Q8IWL6
Gene ID:
Human(282617) Summary: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
Mouse(338374) interferon lambda 3
Rat(685840) interferon, lambda 3
naked mole-rat(101697684) interferon, lambda 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0292 Mouse IL-28A/B ELISA for serum, plasma and cell culture supernatant mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172139 Rosetta Predictions human pricing
XM_001065467 Rosetta Predictions rat pricing
NM_177396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171729 predicted 313
2 SASI_Hs01_00171730 predicted 312
3 SASI_Hs01_00171731 predicted 311
4 SASI_Hs01_00171732 predicted 157
5 SASI_Hs01_00171733 predicted 143
6 SASI_Hs01_00171734 predicted 121
7 SASI_Hs01_00171735 predicted 162
8 SASI_Hs01_00171736 predicted 169
9 SASI_Hs01_00171737 predicted 165
10 SASI_Hs01_00171738 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314259 predicted 374
2 SASI_Rn02_00314260 predicted 535
3 SASI_Rn02_00314261 predicted 554
4 SASI_Rn02_00314262 predicted 482
5 SASI_Rn02_00314263 predicted 558
6 SASI_Rn02_00314264 predicted 525
7 SASI_Rn02_00314265 predicted 528
8 SASI_Rn02_00314266 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164738 predicted 297
2 SASI_Mm01_00164742 predicted 298
3 SASI_Mm02_00347595 predicted 512
4 SASI_Mm02_00347596 predicted 511
5 SASI_Mm01_00164735 predicted 348
6 SASI_Mm01_00164736 predicted 300
7 SASI_Mm01_00164737 predicted 297
8 SASI_Mm01_00164739 predicted 351
9 SASI_Mm01_00164740 predicted 338
10 SASI_Mm01_00164741 predicted 347
11 SASI_Mm01_00164743 predicted 299
12 SASI_Mm01_00164744 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177396
IFNL3 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-314s1c1
Sequence:CCGGACATAAATGACTCAGCCCTGACTCGAGTCAGGGCTGAGTCATTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-298s1c1
Sequence:CCGGCTGAAGGTCTGGGAGAACATACTCGAGTATGTTCTCCCAGACCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-562s21c1
Sequence:CCGGAGTGGAGACCAGTGTGTCTGACTCGAGTCAGACACACTGGTCTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-37s21c1
Sequence:CCGGGTGCTGACAAGAACCCAAGCTCTCGAGAGCTTGGGTTCTTGTCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-509s21c1
Sequence:CCGGCTGTCACCTCCAACCTGTTTCCTCGAGGAAACAGGTTGGAGGTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177396
IFNL3 MISSION shRNA shRNA Plasmid DNA
interferon, lambda 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-314s1c1
Sequence:CCGGACATAAATGACTCAGCCCTGACTCGAGTCAGGGCTGAGTCATTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-298s1c1
Sequence:CCGGCTGAAGGTCTGGGAGAACATACTCGAGTATGTTCTCCCAGACCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-562s21c1
Sequence:CCGGAGTGGAGACCAGTGTGTCTGACTCGAGTCAGACACACTGGTCTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-37s21c1
Sequence:CCGGGTGCTGACAAGAACCCAAGCTCTCGAGAGCTTGGGTTCTTGTCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-509s21c1
Sequence:CCGGCTGTCACCTCCAACCTGTTTCCTCGAGGAAACAGGTTGGAGGTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177396
IFNL3 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-314s1c1
Sequence:CCGGACATAAATGACTCAGCCCTGACTCGAGTCAGGGCTGAGTCATTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-91s1c1
Sequence:CCGGGAAGCAAAGGATTGCCACATTCTCGAGAATGTGGCAATCCTTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-298s1c1
Sequence:CCGGCTGAAGGTCTGGGAGAACATACTCGAGTATGTTCTCCCAGACCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177396.1-355s1c1
Sequence:CCGGCTTCATACACTGAGCCACATTCTCGAGAATGTGGCTCAGTGTATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-562s21c1
Sequence:CCGGAGTGGAGACCAGTGTGTCTGACTCGAGTCAGACACACTGGTCTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-37s21c1
Sequence:CCGGGTGCTGACAAGAACCCAAGCTCTCGAGAGCTTGGGTTCTTGTCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177396.1-509s21c1
Sequence:CCGGCTGTCACCTCCAACCTGTTTCCTCGAGGAAACAGGTTGGAGGTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172139
IFNL3 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-122s1c1
Sequence:CCGGGCCCAGTTCAAGTCCCTGTCTCTCGAGAGACAGGGACTTGAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-379s1c1
Sequence:CCGGCCTGCACCATATCCTCTCCCACTCGAGTGGGAGAGGATATGGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-193s1c1
Sequence:CCGGGCTTCTGCTGAAGGACTGCAACTCGAGTTGCAGTCCTTCAGCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-111s1c1
Sequence:CCGGGCTGCCACATAGCCCAGTTCACTCGAGTGAACTGGGCTATGTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-369s1c1
Sequence:CCGGCCCTTCACACCCTGCACCATACTCGAGTATGGTGCAGGGTGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172139
IFNL3 MISSION shRNA shRNA Plasmid DNA
interferon, lambda 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-122s1c1
Sequence:CCGGGCCCAGTTCAAGTCCCTGTCTCTCGAGAGACAGGGACTTGAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-379s1c1
Sequence:CCGGCCTGCACCATATCCTCTCCCACTCGAGTGGGAGAGGATATGGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-193s1c1
Sequence:CCGGGCTTCTGCTGAAGGACTGCAACTCGAGTTGCAGTCCTTCAGCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-111s1c1
Sequence:CCGGGCTGCCACATAGCCCAGTTCACTCGAGTGAACTGGGCTATGTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-369s1c1
Sequence:CCGGCCCTTCACACCCTGCACCATACTCGAGTATGGTGCAGGGTGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172139
IFNL3 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-122s1c1
Sequence:CCGGGCCCAGTTCAAGTCCCTGTCTCTCGAGAGACAGGGACTTGAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-379s1c1
Sequence:CCGGCCTGCACCATATCCTCTCCCACTCGAGTGGGAGAGGATATGGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-193s1c1
Sequence:CCGGGCTTCTGCTGAAGGACTGCAACTCGAGTTGCAGTCCTTCAGCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-111s1c1
Sequence:CCGGGCTGCCACATAGCCCAGTTCACTCGAGTGAACTGGGCTATGTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172139.2-369s1c1
Sequence:CCGGCCCTTCACACCCTGCACCATACTCGAGTATGGTGCAGGGTGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)