EMAIL THIS PAGE TO A FRIEND

IFNW1

interferon, omega 1

29 Gene Product Result for
Species: Human IFNW1(3467), naked mole-rat Ifnw1(101699391), cow IFNW1(281847), domestic cat IFNW1(751844)
UniProtKB ID: P05000, Q13168, Q5U802, Q5VWD0, Q7M4P5
Gene ID:
naked mole-rat(101699391) interferon, omega 1
cow(281847) interferon, omega 1
domestic cat(751844) interferon, omega 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002177 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138864 predicted 684
2 SASI_Hs01_00138865 predicted 1018
3 SASI_Hs01_00138866 predicted 607
4 SASI_Hs01_00138867 predicted 1013
5 SASI_Hs01_00138868 predicted 1021
6 SASI_Hs01_00138869 predicted 623
7 SASI_Hs01_00138870 predicted 677
8 SASI_Hs01_00138871 predicted 613
9 SASI_Hs01_00138873 predicted 665
10 SASI_Hs02_00333389 predicted 941
11 SASI_Hs01_00138872 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002177
IFNW1 MISSION shRNA Bacterial Glycerol Stock
interferon, omega 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002177.1-1285s1c1
Sequence:CCGGCGGTATATTAAGCCAGTATATCTCGAGATATACTGGCTTAATATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-668s1c1
Sequence:CCGGCCTACTTAGCAGGAACACCTTCTCGAGAAGGTGTTCCTGCTAAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-604s1c1
Sequence:CCGGCCCTAGTGATGACCAGCTATACTCGAGTATAGCTGGTCATCACTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-1114s1c1
Sequence:CCGGACATGCAAGAAAGACTGAGAACTCGAGTTCTCAGTCTTTCTTGCATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-685s1c1
Sequence:CCGGCCTTGGTGCTTCTGCACCAAACTCGAGTTTGGTGCAGAAGCACCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002177.1-1021s21c1
Sequence:CCGGGAATCCGTGTCTACCTGAAAGCTCGAGCTTTCAGGTAGACACGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1226s21c1
Sequence:CCGGAGACTCTTATTTCGGCTTTAACTCGAGTTAAAGCCGAAATAAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1332s21c1
Sequence:CCGGTCAGTCCCTAAGATGTTATTTCTCGAGAAATAACATCTTAGGGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002177
IFNW1 MISSION shRNA shRNA Plasmid DNA
interferon, omega 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002177.1-1285s1c1
Sequence:CCGGCGGTATATTAAGCCAGTATATCTCGAGATATACTGGCTTAATATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-668s1c1
Sequence:CCGGCCTACTTAGCAGGAACACCTTCTCGAGAAGGTGTTCCTGCTAAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-604s1c1
Sequence:CCGGCCCTAGTGATGACCAGCTATACTCGAGTATAGCTGGTCATCACTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-1114s1c1
Sequence:CCGGACATGCAAGAAAGACTGAGAACTCGAGTTCTCAGTCTTTCTTGCATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-685s1c1
Sequence:CCGGCCTTGGTGCTTCTGCACCAAACTCGAGTTTGGTGCAGAAGCACCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002177.1-1021s21c1
Sequence:CCGGGAATCCGTGTCTACCTGAAAGCTCGAGCTTTCAGGTAGACACGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1226s21c1
Sequence:CCGGAGACTCTTATTTCGGCTTTAACTCGAGTTAAAGCCGAAATAAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1332s21c1
Sequence:CCGGTCAGTCCCTAAGATGTTATTTCTCGAGAAATAACATCTTAGGGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002177
IFNW1 MISSION shRNA Lentiviral Transduction Particles
interferon, omega 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002177.1-1285s1c1
Sequence:CCGGCGGTATATTAAGCCAGTATATCTCGAGATATACTGGCTTAATATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-668s1c1
Sequence:CCGGCCTACTTAGCAGGAACACCTTCTCGAGAAGGTGTTCCTGCTAAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-604s1c1
Sequence:CCGGCCCTAGTGATGACCAGCTATACTCGAGTATAGCTGGTCATCACTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-1114s1c1
Sequence:CCGGACATGCAAGAAAGACTGAGAACTCGAGTTCTCAGTCTTTCTTGCATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002177.1-685s1c1
Sequence:CCGGCCTTGGTGCTTCTGCACCAAACTCGAGTTTGGTGCAGAAGCACCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002177.1-1021s21c1
Sequence:CCGGGAATCCGTGTCTACCTGAAAGCTCGAGCTTTCAGGTAGACACGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1226s21c1
Sequence:CCGGAGACTCTTATTTCGGCTTTAACTCGAGTTAAAGCCGAAATAAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372510    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002177.1-1332s21c1
Sequence:CCGGTCAGTCCCTAAGATGTTATTTCTCGAGAAATAACATCTTAGGGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)