EMAIL THIS PAGE TO A FRIEND

IFRD1

interferon-related developmental regulator 1

110 Gene Product Result for
Synonyms: PC4 TIS7
UniProtKB ID: O00458, B7Z5G1, O75234, Q5U013, Q9BVE4
Gene ID:
Human(3475) Summary: This gene is an immediate early gene that encodes a protein related to interferon-gamma. This protein may function as a transcriptional co-activator/repressor that controls the growth and differentiation of specific cell types during embryonic development and tissue regeneration. Mutations in this gene are associated with sensory/motor neuropathy with ataxia. This gene may also be involved in modulating the pathogenesis of cystic fibrosis lung disease. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Mouse(15982) interferon-related developmental regulator 1
Rat(29596) interferon-related developmental regulator 1
Zebrafish(555178) interferon-related developmental regulator 1
dog(482408) interferon-related developmental regulator 1
cow(541283) interferon-related developmental regulator 1
domestic cat(101083070) interferon-related developmental regulator 1
chicken(395226) interferon-related developmental regulator 1
sheep(101112558) interferon-related developmental regulator 1
domestic guinea pig(100727497) interferon-related developmental regulator 1
naked mole-rat(101719793) interferon-related developmental regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108637 Anti-IFRD1 affinity isolated antibody rat, guinea pig, horse, bovine, human, dog, rabbit, mouse
western blot pricing
AV54584 Anti-IFRD1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rat, canine, horse, mouse, rabbit, pig, bovine, human
western blot pricing
AV54585 Anti-IFRD1 (AB2) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, horse, human, dog, guinea pig, bovine
western blot pricing
SAB1406008 Anti-IFRD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA024122 Anti-IFRD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
T2576 Monoclonal Anti-TIS7 antibody produced in mouse ~2 mg/mL, clone IRT537, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001550 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007245 Rosetta Predictions human pricing
NM_001550 Rosetta Predictions human pricing
NM_019242 Rosetta Predictions rat pricing
NM_013562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305263 predicted 2094
2 SASI_Hs02_00305264 predicted 2151
3 SASI_Hs01_00118161 predicted 1558
4 SASI_Hs02_00305265 predicted 2096
5 SASI_Hs01_00118163 predicted 1284
6 SASI_Hs02_00305266 predicted 2108
7 SASI_Hs02_00305267 predicted 2148
8 SASI_Hs02_00305268 predicted 1499
9 SASI_Hs02_00305269 predicted 1600
10 SASI_Hs02_00305270 predicted 1569
11 SASI_Hs01_00118158 predicted 791
12 SASI_Hs01_00118159 predicted 1235
13 SASI_Hs01_00118160 predicted 1236
14 SASI_Hs01_00118162 predicted 1301
15 SASI_Hs01_00118164 predicted 1148
16 SASI_Hs01_00118165 predicted 1614
17 SASI_Hs01_00118166 predicted 856
18 SASI_Hs01_00118167 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332100 predicted 1877
2 SASI_Hs02_00332101 predicted 1944
3 SASI_Hs01_00032622 predicted 1343
4 SASI_Hs02_00332102 predicted 1885
5 SASI_Hs01_00032624 predicted 1073
6 SASI_Hs02_00332103 predicted 1890
7 SASI_Hs02_00332104 predicted 1928
8 SASI_Hs02_00332105 predicted 1289
9 SASI_Hs02_00332106 predicted 1383
10 SASI_Hs02_00332107 predicted 1360
11 SASI_Hs01_00032619 predicted 577
12 SASI_Hs01_00032620 predicted 1014
13 SASI_Hs01_00032621 predicted 1021
14 SASI_Hs01_00032623 predicted 1090
15 SASI_Hs01_00032625 predicted 937
16 SASI_Hs01_00032626 predicted 1404
17 SASI_Hs01_00032627 predicted 646
18 SASI_Hs01_00032628 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072027 predicted 1377
2 SASI_Rn01_00072028 predicted 369
3 SASI_Rn02_00262118 predicted 1304
4 SASI_Rn01_00072029 predicted 254
5 SASI_Rn01_00072031 predicted 996
6 SASI_Rn01_00072032 predicted 888
7 SASI_Rn01_00072033 predicted 409
8 SASI_Rn01_00072034 predicted 245
9 SASI_Rn01_00072035 predicted 269
10 SASI_Rn01_00072036 predicted 1252
11 SASI_Rn01_00072030 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069218 predicted 1435
2 SASI_Mm01_00069219 predicted 1316
3 SASI_Mm01_00069220 predicted 1264
4 SASI_Mm01_00069221 predicted 955
5 SASI_Mm01_00069222 predicted 1531
6 SASI_Mm01_00069223 predicted 431
7 SASI_Mm01_00069224 predicted 1064
8 SASI_Mm01_00069225 predicted 425
9 SASI_Mm01_00069226 predicted 475
10 SASI_Mm02_00322301 predicted 313
11 SASI_Mm01_00069227 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013562
VALIDATED
IFRD1 MISSION shRNA Bacterial Glycerol Stock
interferon-related developmental regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-705s21c1
Sequence:CCGGGACTCTTGGACCAATCCTAAACTCGAGTTTAGGATTGGTCCAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-812s21c1
Sequence:CCGGATGATATCACTGAGCTGTATTCTCGAGAATACAGCTCAGTGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-934s21c1
Sequence:CCGGTCGCTTCTCGCGTGGACATTACTCGAGTAATGTCCACGCGAGAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-1318s21c1
Sequence:CCGGCATACCTATGACACGTTTAAACTCGAGTTTAAACGTGTCATAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013562.1-1563s21c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1360s1c1
Sequence:CCGGCAGTACCACTTGCAGACAAATCTCGAGATTTGTCTGCAAGTGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-406s1c1
Sequence:CCGGCCAGAAGTTCTTGATGAGGAACTCGAGTTCCTCATCAAGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1563s1c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1487s1c1
Sequence:CCGGCAGCTTTCAAAGCTCGAACAACTCGAGTTGTTCGAGCTTTGAAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1359s1c1
Sequence:CCGGGCAGTACCACTTGCAGACAAACTCGAGTTTGTCTGCAAGTGGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013562
VALIDATED
IFRD1 MISSION shRNA shRNA Plasmid DNA
interferon-related developmental regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-705s21c1
Sequence:CCGGGACTCTTGGACCAATCCTAAACTCGAGTTTAGGATTGGTCCAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-812s21c1
Sequence:CCGGATGATATCACTGAGCTGTATTCTCGAGAATACAGCTCAGTGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-934s21c1
Sequence:CCGGTCGCTTCTCGCGTGGACATTACTCGAGTAATGTCCACGCGAGAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-1318s21c1
Sequence:CCGGCATACCTATGACACGTTTAAACTCGAGTTTAAACGTGTCATAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013562.1-1563s21c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1360s1c1
Sequence:CCGGCAGTACCACTTGCAGACAAATCTCGAGATTTGTCTGCAAGTGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-406s1c1
Sequence:CCGGCCAGAAGTTCTTGATGAGGAACTCGAGTTCCTCATCAAGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1563s1c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1487s1c1
Sequence:CCGGCAGCTTTCAAAGCTCGAACAACTCGAGTTGTTCGAGCTTTGAAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1359s1c1
Sequence:CCGGGCAGTACCACTTGCAGACAAACTCGAGTTTGTCTGCAAGTGGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013562
VALIDATED
IFRD1 MISSION shRNA Lentiviral Transduction Particles
interferon-related developmental regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-705s21c1
Sequence:CCGGGACTCTTGGACCAATCCTAAACTCGAGTTTAGGATTGGTCCAAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-812s21c1
Sequence:CCGGATGATATCACTGAGCTGTATTCTCGAGAATACAGCTCAGTGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-934s21c1
Sequence:CCGGTCGCTTCTCGCGTGGACATTACTCGAGTAATGTCCACGCGAGAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013562.1-1318s21c1
Sequence:CCGGCATACCTATGACACGTTTAAACTCGAGTTTAAACGTGTCATAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013562.1-1563s21c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1360s1c1
Sequence:CCGGCAGTACCACTTGCAGACAAATCTCGAGATTTGTCTGCAAGTGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-406s1c1
Sequence:CCGGCCAGAAGTTCTTGATGAGGAACTCGAGTTCCTCATCAAGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1563s1c1
Sequence:CCGGGTCTGAATTTGATGGCTGTTTCTCGAGAAACAGCCATCAAATTCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1487s1c1
Sequence:CCGGCAGCTTTCAAAGCTCGAACAACTCGAGTTGTTCGAGCTTTGAAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013562.1-1359s1c1
Sequence:CCGGGCAGTACCACTTGCAGACAAACTCGAGTTTGTCTGCAAGTGGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001550
IFRD1 MISSION shRNA Bacterial Glycerol Stock
interferon-related developmental regulator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-655s1c1
Sequence:CCGGGCAGCGTTAGCATCTGTTCTTCTCGAGAAGAACAGATGCTAACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1523s1c1
Sequence:CCGGGAACCAAAGCTAGAAGCAAATCTCGAGATTTGCTTCTAGCTTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-820s1c1
Sequence:CCGGGCCACAGATGACATTACTGAACTCGAGTTCAGTAATGTCATCTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1531s1c1
Sequence:CCGGGCTAGAAGCAAATGTCGAGATCTCGAGATCTCGACATTTGCTTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-386s1c1
Sequence:CCGGGTTATAGCGATCCTTCCAGTTCTCGAGAACTGGAAGGATCGCTATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1546s1c1
Sequence:CCGGCGAGATAAGAGAGCAGATGTTCTCGAGAACATCTGCTCTCTTATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-380s1c1
Sequence:CCGGGCAGTGGTTATAGCGATCCTTCTCGAGAAGGATCGCTATAACCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1171s1c1
Sequence:CCGGGCCTTGGCAACAGATGGAAATCTCGAGATTTCCATCTGTTGCCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-321s1c1
Sequence:CCGGGCATCGAAATGTTCAGCCTTTCTCGAGAAAGGCTGAACATTTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001550
IFRD1 MISSION shRNA shRNA Plasmid DNA
interferon-related developmental regulator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-655s1c1
Sequence:CCGGGCAGCGTTAGCATCTGTTCTTCTCGAGAAGAACAGATGCTAACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1523s1c1
Sequence:CCGGGAACCAAAGCTAGAAGCAAATCTCGAGATTTGCTTCTAGCTTTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-820s1c1
Sequence:CCGGGCCACAGATGACATTACTGAACTCGAGTTCAGTAATGTCATCTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1531s1c1
Sequence:CCGGGCTAGAAGCAAATGTCGAGATCTCGAGATCTCGACATTTGCTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-386s1c1
Sequence:CCGGGTTATAGCGATCCTTCCAGTTCTCGAGAACTGGAAGGATCGCTATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1546s1c1
Sequence:CCGGCGAGATAAGAGAGCAGATGTTCTCGAGAACATCTGCTCTCTTATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-380s1c1
Sequence:CCGGGCAGTGGTTATAGCGATCCTTCTCGAGAAGGATCGCTATAACCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1171s1c1
Sequence:CCGGGCCTTGGCAACAGATGGAAATCTCGAGATTTCCATCTGTTGCCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-321s1c1
Sequence:CCGGGCATCGAAATGTTCAGCCTTTCTCGAGAAAGGCTGAACATTTCGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001550
IFRD1 MISSION shRNA Lentiviral Transduction Particles
interferon-related developmental regulator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-655s1c1
Sequence:CCGGGCAGCGTTAGCATCTGTTCTTCTCGAGAAGAACAGATGCTAACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1523s1c1
Sequence:CCGGGAACCAAAGCTAGAAGCAAATCTCGAGATTTGCTTCTAGCTTTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-820s1c1
Sequence:CCGGGCCACAGATGACATTACTGAACTCGAGTTCAGTAATGTCATCTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1531s1c1
Sequence:CCGGGCTAGAAGCAAATGTCGAGATCTCGAGATCTCGACATTTGCTTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-386s1c1
Sequence:CCGGGTTATAGCGATCCTTCCAGTTCTCGAGAACTGGAAGGATCGCTATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1546s1c1
Sequence:CCGGCGAGATAAGAGAGCAGATGTTCTCGAGAACATCTGCTCTCTTATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-380s1c1
Sequence:CCGGGCAGTGGTTATAGCGATCCTTCTCGAGAAGGATCGCTATAACCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-1171s1c1
Sequence:CCGGGCCTTGGCAACAGATGGAAATCTCGAGATTTCCATCTGTTGCCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001550.1-321s1c1
Sequence:CCGGGCATCGAAATGTTCAGCCTTTCTCGAGAAAGGCTGAACATTTCGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)