EMAIL THIS PAGE TO A FRIEND

IFRD2

interferon-related developmental regulator 2

64 Gene Product Result for
Synonyms: IFNRP SKMc15 SM15
UniProtKB ID: Q12894, Q9BVB4
Gene ID:
Mouse(15983) interferon-related developmental regulator 2
Rat(300994) interferon-related developmental regulator 2
domestic guinea pig(100733539) interferon-related developmental regulator 2
naked mole-rat(101699841) interferon-related developmental regulator 2
sheep(101115914) interferon-related developmental regulator 2
Zebrafish(445227) interferon-related developmental regulator 2
domestic cat(101092670) interferon-related developmental regulator 2
dog(484761) interferon-related developmental regulator 2
cow(767939) interferon-related developmental regulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035001 MISSION® esiRNA esiRNA targeting mouse Ifrd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006764 Rosetta Predictions human pricing
NM_001047871 Rosetta Predictions rat pricing
NM_025903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165171 predicted 1271
2 SASI_Hs01_00165173 predicted 1254
3 SASI_Hs01_00165174 predicted 1366
4 SASI_Hs01_00165175 predicted 874
5 SASI_Hs01_00165176 predicted 448
6 SASI_Hs01_00165177 predicted 1086
7 SASI_Hs01_00165178 predicted 1146
8 SASI_Hs02_00342263 predicted 1167
9 SASI_Hs01_00165179 predicted 965
10 SASI_Hs01_00165180 predicted 781
11 SASI_Hs01_00165172 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206377 predicted 1358
2 SASI_Rn02_00206378 predicted 1166
3 SASI_Rn02_00206379 predicted 1276
4 SASI_Rn02_00206380 predicted 1629
5 SASI_Rn02_00206381 predicted 1137
6 SASI_Rn02_00206382 predicted 1557
7 SASI_Rn02_00206383 predicted 952
8 SASI_Rn02_00206384 predicted 1430
9 SASI_Rn02_00206385 predicted 1313
10 SASI_Rn02_00206386 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088945 predicted 1567
2 SASI_Mm01_00088946 predicted 243
3 SASI_Mm01_00088947 predicted 1502
4 SASI_Mm01_00088948 predicted 1162
5 SASI_Mm01_00088949 predicted 916
6 SASI_Mm01_00088950 predicted 1256
7 SASI_Mm01_00088952 predicted 1511
8 SASI_Mm01_00088953 predicted 398
9 SASI_Mm01_00088954 predicted 1387
10 SASI_Mm02_00329258 predicted 1082
11 SASI_Mm01_00088951 predicted 1390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025903
VALIDATED
IFRD2 MISSION shRNA Bacterial Glycerol Stock
interferon-related developmental regulator 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1390s21c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-982s21c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1575s1c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-983s1c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1265s1c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1395s1c1
Sequence:CCGGGCAAGATTTCACGCTTTGAAACTCGAGTTTCAAAGCGTGAAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1391s1c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025903.2-1574s21c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1264s21c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025903
VALIDATED
IFRD2 MISSION shRNA shRNA Plasmid DNA
interferon-related developmental regulator 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1390s21c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-982s21c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1575s1c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-983s1c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1265s1c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1395s1c1
Sequence:CCGGGCAAGATTTCACGCTTTGAAACTCGAGTTTCAAAGCGTGAAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1391s1c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025903.2-1574s21c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1264s21c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025903
VALIDATED
IFRD2 MISSION shRNA Lentiviral Transduction Particles
interferon-related developmental regulator 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1390s21c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-982s21c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1575s1c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-983s1c1
Sequence:CCGGGAAAGTGTGAACCTGCGGATTCTCGAGAATCCGCAGGTTCACACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1265s1c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1395s1c1
Sequence:CCGGGCAAGATTTCACGCTTTGAAACTCGAGTTTCAAAGCGTGAAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025903.1-1391s1c1
Sequence:CCGGGCCTGCAAGATTTCACGCTTTCTCGAGAAAGCGTGAAATCTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025903.2-1574s21c1
Sequence:CCGGCCAGTGATTGTCACTTTATTTCTCGAGAAATAAAGTGACAATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025903.2-1264s21c1
Sequence:CCGGCGCATCTACACAGCCTTCAAACTCGAGTTTGAAGGCTGTGTAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006764
VALIDATED
IFRD2 MISSION shRNA Bacterial Glycerol Stock
interferon-related developmental regulator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1062s21c1
Sequence:CCGGCATCTGCCCTAGCACCCAAATCTCGAGATTTGGGTGCTAGGGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1576s21c1
Sequence:CCGGTACAATGCTGCTGCCTTCAAACTCGAGTTTGAAGGCAGCAGCATTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1621s1c1
Sequence:CCGGCCACCAGTATTTGTCACTTTACTCGAGTAAAGTGACAAATACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1249s1c1
Sequence:CCGGCGAAGAAGAGATAGTGCGCTTCTCGAGAAGCGCACTATCTCTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006764.3-1309s1c1
Sequence:CCGGCCGGATCTACGCTGCCTTCAACTCGAGTTGAAGGCAGCGTAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1027s1c1
Sequence:CCGGTGAAAGTGTGAACCTGCGGATCTCGAGATCCGCAGGTTCACACTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1378s21c1
Sequence:CCGGGGCTTTGAGGTGCTCTACATGCTCGAGCATGTAGAGCACCTCAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006764.4-1862s21c1
Sequence:CCGGTGTCTCAGGCCAGGCTAAATACTCGAGTATTTAGCCTGGCCTGAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1162s1c2
Sequence:CCGGCAGTAACAAGTACCGTGCCAACTCGAGTTGGCACGGTACTTGTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1481s21c1
Sequence:CCGGAGCTACTCCGTGACATCTTTGCTCGAGCAAAGATGTCACGGAGTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006764
VALIDATED
IFRD2 MISSION shRNA shRNA Plasmid DNA
interferon-related developmental regulator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1062s21c1
Sequence:CCGGCATCTGCCCTAGCACCCAAATCTCGAGATTTGGGTGCTAGGGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1576s21c1
Sequence:CCGGTACAATGCTGCTGCCTTCAAACTCGAGTTTGAAGGCAGCAGCATTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1621s1c1
Sequence:CCGGCCACCAGTATTTGTCACTTTACTCGAGTAAAGTGACAAATACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1249s1c1
Sequence:CCGGCGAAGAAGAGATAGTGCGCTTCTCGAGAAGCGCACTATCTCTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006764.3-1309s1c1
Sequence:CCGGCCGGATCTACGCTGCCTTCAACTCGAGTTGAAGGCAGCGTAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1027s1c1
Sequence:CCGGTGAAAGTGTGAACCTGCGGATCTCGAGATCCGCAGGTTCACACTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1378s21c1
Sequence:CCGGGGCTTTGAGGTGCTCTACATGCTCGAGCATGTAGAGCACCTCAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006764.4-1862s21c1
Sequence:CCGGTGTCTCAGGCCAGGCTAAATACTCGAGTATTTAGCCTGGCCTGAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1162s1c2
Sequence:CCGGCAGTAACAAGTACCGTGCCAACTCGAGTTGGCACGGTACTTGTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1481s21c1
Sequence:CCGGAGCTACTCCGTGACATCTTTGCTCGAGCAAAGATGTCACGGAGTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006764
VALIDATED
IFRD2 MISSION shRNA Lentiviral Transduction Particles
interferon-related developmental regulator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1062s21c1
Sequence:CCGGCATCTGCCCTAGCACCCAAATCTCGAGATTTGGGTGCTAGGGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1576s21c1
Sequence:CCGGTACAATGCTGCTGCCTTCAAACTCGAGTTTGAAGGCAGCAGCATTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1621s1c1
Sequence:CCGGCCACCAGTATTTGTCACTTTACTCGAGTAAAGTGACAAATACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1249s1c1
Sequence:CCGGCGAAGAAGAGATAGTGCGCTTCTCGAGAAGCGCACTATCTCTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006764.3-1309s1c1
Sequence:CCGGCCGGATCTACGCTGCCTTCAACTCGAGTTGAAGGCAGCGTAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1027s1c1
Sequence:CCGGTGAAAGTGTGAACCTGCGGATCTCGAGATCCGCAGGTTCACACTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1378s21c1
Sequence:CCGGGGCTTTGAGGTGCTCTACATGCTCGAGCATGTAGAGCACCTCAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006764.4-1862s21c1
Sequence:CCGGTGTCTCAGGCCAGGCTAAATACTCGAGTATTTAGCCTGGCCTGAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006764.3-1162s1c2
Sequence:CCGGCAGTAACAAGTACCGTGCCAACTCGAGTTGGCACGGTACTTGTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006764.4-1481s21c1
Sequence:CCGGAGCTACTCCGTGACATCTTTGCTCGAGCAAAGATGTCACGGAGTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)