EMAIL THIS PAGE TO A FRIEND

IFT122

intraflagellar transport 122 homolog (Chlamydomonas)

90 Gene Product Result for
Synonyms: CED CED1 SPG WDR10 WDR10p WDR140
Gene ID:
Human(55764) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(81896) intraflagellar transport 122
Rat(312651) intraflagellar transport 122 homolog (Chlamydomonas)
Zebrafish(405826) intraflagellar transport 122 homolog (Chlamydomonas)
cow(536731) intraflagellar transport 122 homolog (Chlamydomonas)
Horse(100050891) intraflagellar transport 122 homolog (Chlamydomonas)
domestic cat(101098043) intraflagellar transport 122 homolog (Chlamydomonas)
dog(476528) intraflagellar transport 122 homolog (Chlamydomonas)
chicken(416123) intraflagellar transport 122 homolog (Chlamydomonas)
sheep(101123504) intraflagellar transport 122 homolog (Chlamydomonas)
domestic guinea pig(100715655) intraflagellar transport 122 homolog (Chlamydomonas)
naked mole-rat(101725912) intraflagellar transport 122 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018262 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018262 Rosetta Predictions human pricing
NM_052985 Rosetta Predictions human pricing
NM_052989 Rosetta Predictions human pricing
NM_052990 Rosetta Predictions human pricing
XM_001054604 Rosetta Predictions rat pricing
XM_001057925 Rosetta Predictions rat pricing
NM_031177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245352 predicted 1095
2 SASI_Hs02_00351628 predicted 1051
3 SASI_Hs01_00245354 predicted 1167
4 SASI_Hs01_00245355 predicted 1254
5 SASI_Hs01_00245356 predicted 2595
6 SASI_Hs02_00351629 predicted 1435
7 SASI_Hs01_00245357 predicted 1118
8 SASI_Hs01_00245358 predicted 1256
9 SASI_Hs01_00245359 predicted 1172
10 SASI_Hs01_00245360 predicted 2457
11 SASI_Hs01_00245353 predicted 1270
12 SASI_Hs01_00245361 predicted 3398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237985 predicted 1428
2 SASI_Hs02_00361790 predicted 1382
3 SASI_Hs01_00237987 predicted 1491
4 SASI_Hs01_00237988 predicted 1581
5 SASI_Hs01_00237989 predicted 2928
6 SASI_Hs02_00361791 predicted 1761
7 SASI_Hs01_00237990 predicted 1453
8 SASI_Hs01_00237991 predicted 1586
9 SASI_Hs01_00237992 predicted 1507
10 SASI_Hs01_00237993 predicted 2793
11 SASI_Hs01_00237986 predicted 1600
12 SASI_Hs01_00237994 predicted 3734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016876 predicted 1266
2 SASI_Hs02_00361805 predicted 1233
3 SASI_Hs01_00016878 predicted 1342
4 SASI_Hs01_00016879 predicted 1433
5 SASI_Hs01_00016880 predicted 2771
6 SASI_Hs02_00361806 predicted 1612
7 SASI_Hs01_00016881 predicted 1304
8 SASI_Hs01_00016882 predicted 1436
9 SASI_Hs01_00016883 predicted 1356
10 SASI_Hs01_00016884 predicted 2635
11 SASI_Hs01_00016877 predicted 1440
12 SASI_Hs01_00016885 predicted 3582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188771 predicted 937
2 SASI_Hs02_00361807 predicted 900
3 SASI_Hs01_00188773 predicted 1006
4 SASI_Hs01_00188774 predicted 1096
5 SASI_Hs01_00188775 predicted 2439
6 SASI_Hs02_00361808 predicted 1277
7 SASI_Hs01_00188776 predicted 967
8 SASI_Hs01_00188777 predicted 1104
9 SASI_Hs01_00188778 predicted 1018
10 SASI_Hs01_00188779 predicted 2300
11 SASI_Hs01_00188772 predicted 1114
12 SASI_Hs01_00188780 predicted 3248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276440 predicted 1115
2 SASI_Rn02_00276441 predicted 831
3 SASI_Rn02_00276442 predicted 319
4 SASI_Rn02_00276443 predicted 259
5 SASI_Rn02_00276444 predicted 914
6 SASI_Rn02_00276445 predicted 1876
7 SASI_Rn02_00276446 predicted 267
8 SASI_Rn02_00276447 predicted 1788
9 SASI_Rn02_00276448 predicted 358
10 SASI_Rn02_00276449 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287993 predicted 1112
2 SASI_Rn02_00287994 predicted 829
3 SASI_Rn02_00287995 predicted 319
4 SASI_Rn02_00287996 predicted 258
5 SASI_Rn02_00287997 predicted 915
6 SASI_Rn02_00287998 predicted 1883
7 SASI_Rn02_00287999 predicted 273
8 SASI_Rn02_00288000 predicted 1789
9 SASI_Rn02_00288001 predicted 362
10 SASI_Rn02_00288002 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337013 predicted 1452
2 SASI_Mm01_00076681 predicted 3350
3 SASI_Mm01_00076682 predicted 285
4 SASI_Mm01_00076683 predicted 3312
5 SASI_Mm01_00076684 predicted 354
6 SASI_Mm01_00076685 predicted 943
7 SASI_Mm01_00076686 predicted 853
8 SASI_Mm01_00076687 predicted 749
9 SASI_Mm01_00076688 predicted 824
10 SASI_Mm01_00076690 predicted 389
11 SASI_Mm01_00076689 predicted 2696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018262
VALIDATED
IFT122 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 122 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1289s21c1
Sequence:CCGGAGACATGCATTACCGGGTAAACTCGAGTTTACCCGGTAATGCATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-2033s21c1
Sequence:CCGGAGTACAAGACCTCCGATATTTCTCGAGAAATATCGGAGGTCTTGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1985s21c1
Sequence:CCGGAGCGCTAGAAGGTTTAGATTTCTCGAGAAATCTAAACCTTCTAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-2755s1c1
Sequence:CCGGGCAGGTTTAATGATGCTGCCTCTCGAGAGGCAGCATCATTAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-761s1c1
Sequence:CCGGCCCTTCAAGAGAGGAACGTAACTCGAGTTACGTTCCTCTCTTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-890s1c1
Sequence:CCGGCTACTTTACTAAAGGCGAGTACTCGAGTACTCGCCTTTAGTAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018262.2-2210s1c1
Sequence:CCGGCGACCTCTGCATGTTTGAGTACTCGAGTACTCAAACATGCAGAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-1196s1c1
Sequence:CCGGGCTTGTCAAGAAGATTGCCATCTCGAGATGGCAATCTTCTTGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018262
VALIDATED
IFT122 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 122 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1289s21c1
Sequence:CCGGAGACATGCATTACCGGGTAAACTCGAGTTTACCCGGTAATGCATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-2033s21c1
Sequence:CCGGAGTACAAGACCTCCGATATTTCTCGAGAAATATCGGAGGTCTTGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1985s21c1
Sequence:CCGGAGCGCTAGAAGGTTTAGATTTCTCGAGAAATCTAAACCTTCTAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-2755s1c1
Sequence:CCGGGCAGGTTTAATGATGCTGCCTCTCGAGAGGCAGCATCATTAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-761s1c1
Sequence:CCGGCCCTTCAAGAGAGGAACGTAACTCGAGTTACGTTCCTCTCTTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-890s1c1
Sequence:CCGGCTACTTTACTAAAGGCGAGTACTCGAGTACTCGCCTTTAGTAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018262.2-2210s1c1
Sequence:CCGGCGACCTCTGCATGTTTGAGTACTCGAGTACTCAAACATGCAGAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-1196s1c1
Sequence:CCGGGCTTGTCAAGAAGATTGCCATCTCGAGATGGCAATCTTCTTGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018262
VALIDATED
IFT122 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 122 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1289s21c1
Sequence:CCGGAGACATGCATTACCGGGTAAACTCGAGTTTACCCGGTAATGCATGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-2033s21c1
Sequence:CCGGAGTACAAGACCTCCGATATTTCTCGAGAAATATCGGAGGTCTTGTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018262.2-1985s21c1
Sequence:CCGGAGCGCTAGAAGGTTTAGATTTCTCGAGAAATCTAAACCTTCTAGCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-2755s1c1
Sequence:CCGGGCAGGTTTAATGATGCTGCCTCTCGAGAGGCAGCATCATTAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-761s1c1
Sequence:CCGGCCCTTCAAGAGAGGAACGTAACTCGAGTTACGTTCCTCTCTTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-890s1c1
Sequence:CCGGCTACTTTACTAAAGGCGAGTACTCGAGTACTCGCCTTTAGTAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018262.2-2210s1c1
Sequence:CCGGCGACCTCTGCATGTTTGAGTACTCGAGTACTCAAACATGCAGAGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018262.2-1196s1c1
Sequence:CCGGGCTTGTCAAGAAGATTGCCATCTCGAGATGGCAATCTTCTTGACAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031177
VALIDATED
IFT122 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 122 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031177.1-3788s1c1
Sequence:CCGGCCCAGATGAAGTTTGTATGTTCTCGAGAACATACAAACTTCATCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.1-3531s1c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-949s1c1
Sequence:CCGGGTGAAACCTGACTCCAATTATCTCGAGATAATTGGAGTCAGGTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-2694s1c1
Sequence:CCGGGTTTAACGACGCTGCCTATTACTCGAGTAATAGGCAGCGTCGTTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-2697s21c1
Sequence:CCGGTAACGACGCTGCCTATTATTACTCGAGTAATAATAGGCAGCGTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-183s21c1
Sequence:CCGGTATCTACGACCTCGGATTTAACTCGAGTTAAATCCGAGGTCGTAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-3835s21c1
Sequence:CCGGTAACCACAGATTTCCTATTTACTCGAGTAAATAGGAAATCTGTGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-3531s21c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-409s21c1
Sequence:CCGGTACACGCACAACGACTCTATACTCGAGTATAGAGTCGTTGTGCGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-182s1c1
Sequence:CCGGGTATCTACGACCTCGGATTTACTCGAGTAAATCCGAGGTCGTAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031177
VALIDATED
IFT122 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 122 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031177.1-3788s1c1
Sequence:CCGGCCCAGATGAAGTTTGTATGTTCTCGAGAACATACAAACTTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.1-3531s1c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-949s1c1
Sequence:CCGGGTGAAACCTGACTCCAATTATCTCGAGATAATTGGAGTCAGGTTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-2694s1c1
Sequence:CCGGGTTTAACGACGCTGCCTATTACTCGAGTAATAGGCAGCGTCGTTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-2697s21c1
Sequence:CCGGTAACGACGCTGCCTATTATTACTCGAGTAATAATAGGCAGCGTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-183s21c1
Sequence:CCGGTATCTACGACCTCGGATTTAACTCGAGTTAAATCCGAGGTCGTAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-3835s21c1
Sequence:CCGGTAACCACAGATTTCCTATTTACTCGAGTAAATAGGAAATCTGTGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-3531s21c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-409s21c1
Sequence:CCGGTACACGCACAACGACTCTATACTCGAGTATAGAGTCGTTGTGCGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-182s1c1
Sequence:CCGGGTATCTACGACCTCGGATTTACTCGAGTAAATCCGAGGTCGTAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031177
VALIDATED
IFT122 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 122 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031177.1-3788s1c1
Sequence:CCGGCCCAGATGAAGTTTGTATGTTCTCGAGAACATACAAACTTCATCTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.1-3531s1c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-949s1c1
Sequence:CCGGGTGAAACCTGACTCCAATTATCTCGAGATAATTGGAGTCAGGTTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-2694s1c1
Sequence:CCGGGTTTAACGACGCTGCCTATTACTCGAGTAATAGGCAGCGTCGTTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-2697s21c1
Sequence:CCGGTAACGACGCTGCCTATTATTACTCGAGTAATAATAGGCAGCGTCGTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-183s21c1
Sequence:CCGGTATCTACGACCTCGGATTTAACTCGAGTTAAATCCGAGGTCGTAGATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-3835s21c1
Sequence:CCGGTAACCACAGATTTCCTATTTACTCGAGTAAATAGGAAATCTGTGGTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031177.2-3531s21c1
Sequence:CCGGGCCGCTGCAATGGCAATATTTCTCGAGAAATATTGCCATTGCAGCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031177.2-409s21c1
Sequence:CCGGTACACGCACAACGACTCTATACTCGAGTATAGAGTCGTTGTGCGTGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031177.2-182s1c1
Sequence:CCGGGTATCTACGACCTCGGATTTACTCGAGTAAATCCGAGGTCGTAGATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)