EMAIL THIS PAGE TO A FRIEND

IFT140

intraflagellar transport 140 homolog (Chlamydomonas)

39 Gene Product Result for
Synonyms: MZSDS WDTC2 c305C8.4 c380F5.1 gs114
UniProtKB ID: Q96RY7, A2A2A8, D3DU75, O60332
Gene ID:
Human(9742) Summary: This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
Mouse(106633) intraflagellar transport 140
Rat(100362124) intraflagellar transport 140
domestic guinea pig(100724425) intraflagellar transport 140 homolog (Chlamydomonas)
naked mole-rat(101713613) intraflagellar transport 140 homolog (Chlamydomonas)
sheep(101109504) intraflagellar transport 140 homolog (Chlamydomonas)
Zebrafish(553213) intraflagellar transport 140 homolog (Chlamydomonas)
cow(100139697) intraflagellar transport 140 homolog (Chlamydomonas)
Horse(100065433) intraflagellar transport 140 homolog (Chlamydomonas)
domestic cat(101084760) intraflagellar transport 140 homolog (Chlamydomonas)
dog(490075) intraflagellar transport 140 homolog (Chlamydomonas)
chicken(416758) intraflagellar transport 140 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014714 Rosetta Predictions human pricing
NM_134126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079060 predicted 2219
2 SASI_Hs01_00079061 predicted 3693
3 SASI_Hs02_00346139 predicted 3970
4 SASI_Hs01_00079063 predicted 1924
5 SASI_Hs01_00079064 predicted 1531
6 SASI_Hs01_00079065 predicted 1523
7 SASI_Hs01_00079066 predicted 981
8 SASI_Hs01_00079067 predicted 296
9 SASI_Hs01_00079068 predicted 969
10 SASI_Hs01_00079069 predicted 2400
11 SASI_Hs01_00079062 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134260 predicted 2012
2 SASI_Mm01_00134262 predicted 2775
3 SASI_Mm02_00339369 predicted 1649
4 SASI_Mm02_00339370 predicted 4008
5 SASI_Mm01_00134264 predicted 3017
6 SASI_Mm01_00134265 predicted 1087
7 SASI_Mm01_00134266 predicted 4174
8 SASI_Mm01_00134267 predicted 2569
9 SASI_Mm02_00339371 predicted 3998
10 SASI_Mm02_00339372 predicted 2700
11 SASI_Mm01_00134261 predicted 461
12 SASI_Mm01_00134263 predicted 1142
13 SASI_Mm01_00134268 predicted 340
14 SASI_Mm01_00134269 predicted 4094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014714
IFT140 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 140 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-1276s21c1
Sequence:CCGGTAGAACGAGGAGAGAATTATACTCGAGTATAATTCTCTCCTCGTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-478s21c1
Sequence:CCGGCAACAGGCAGCGTGGATATTTCTCGAGAAATATCCACGCTGCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-2243s21c1
Sequence:CCGGTAATGAGCAAGAGACTAATAACTCGAGTTATTAGTCTCTTGCTCATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1536s1c1
Sequence:CCGGGTGGAGTCAAACCGAGTTCAACTCGAGTTGAACTCGGTTTGACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-3845s1c1
Sequence:CCGGGAAGAACATCATCGGCTTCTACTCGAGTAGAAGCCGATGATGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014714.2-4469s1c1
Sequence:CCGGCAGAAAGGCATCTTCTGGAATCTCGAGATTCCAGAAGATGCCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014714.2-1940s1c1
Sequence:CCGGGACTAATAAGAGCCACCTCTTCTCGAGAAGAGGTGGCTCTTATTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4722s1c1
Sequence:CCGGCACATTGTAAAGCCTGAGAAACTCGAGTTTCTCAGGCTTTACAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4471s1c1
Sequence:CCGGGAAAGGCATCTTCTGGAATTTCTCGAGAAATTCCAGAAGATGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1178s1c1
Sequence:CCGGCCAAGGAAACATCACGCAAATCTCGAGATTTGCGTGATGTTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014714
IFT140 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 140 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-1276s21c1
Sequence:CCGGTAGAACGAGGAGAGAATTATACTCGAGTATAATTCTCTCCTCGTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-478s21c1
Sequence:CCGGCAACAGGCAGCGTGGATATTTCTCGAGAAATATCCACGCTGCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-2243s21c1
Sequence:CCGGTAATGAGCAAGAGACTAATAACTCGAGTTATTAGTCTCTTGCTCATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1536s1c1
Sequence:CCGGGTGGAGTCAAACCGAGTTCAACTCGAGTTGAACTCGGTTTGACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-3845s1c1
Sequence:CCGGGAAGAACATCATCGGCTTCTACTCGAGTAGAAGCCGATGATGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014714.2-4469s1c1
Sequence:CCGGCAGAAAGGCATCTTCTGGAATCTCGAGATTCCAGAAGATGCCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014714.2-1940s1c1
Sequence:CCGGGACTAATAAGAGCCACCTCTTCTCGAGAAGAGGTGGCTCTTATTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4722s1c1
Sequence:CCGGCACATTGTAAAGCCTGAGAAACTCGAGTTTCTCAGGCTTTACAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4471s1c1
Sequence:CCGGGAAAGGCATCTTCTGGAATTTCTCGAGAAATTCCAGAAGATGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1178s1c1
Sequence:CCGGCCAAGGAAACATCACGCAAATCTCGAGATTTGCGTGATGTTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014714
IFT140 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 140 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-1276s21c1
Sequence:CCGGTAGAACGAGGAGAGAATTATACTCGAGTATAATTCTCTCCTCGTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-478s21c1
Sequence:CCGGCAACAGGCAGCGTGGATATTTCTCGAGAAATATCCACGCTGCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014714.3-2243s21c1
Sequence:CCGGTAATGAGCAAGAGACTAATAACTCGAGTTATTAGTCTCTTGCTCATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1536s1c1
Sequence:CCGGGTGGAGTCAAACCGAGTTCAACTCGAGTTGAACTCGGTTTGACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-3845s1c1
Sequence:CCGGGAAGAACATCATCGGCTTCTACTCGAGTAGAAGCCGATGATGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130651    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014714.2-4469s1c1
Sequence:CCGGCAGAAAGGCATCTTCTGGAATCTCGAGATTCCAGAAGATGCCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014714.2-1940s1c1
Sequence:CCGGGACTAATAAGAGCCACCTCTTCTCGAGAAGAGGTGGCTCTTATTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4722s1c1
Sequence:CCGGCACATTGTAAAGCCTGAGAAACTCGAGTTTCTCAGGCTTTACAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014714.2-4471s1c1
Sequence:CCGGGAAAGGCATCTTCTGGAATTTCTCGAGAAATTCCAGAAGATGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014714.2-1178s1c1
Sequence:CCGGCCAAGGAAACATCACGCAAATCTCGAGATTTGCGTGATGTTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134126
VALIDATED
IFT140 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 140 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-5024s21c1
Sequence:CCGGGAATACCAGATGGCCTATAAGCTCGAGCTTATAGGCCATCTGGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-1274s21c1
Sequence:CCGGCCACTCCTGAAACACGAATATCTCGAGATATTCGTGTTTCAGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-3020s21c1
Sequence:CCGGATGGAAGTGCCTCACTATTACCTCGAGGTAATAGTGAGGCACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-4055s21c1
Sequence:CCGGATTGAGGCAGCCCGGTATTATCTCGAGATAATACCGGGCTGCCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-5260s21c1
Sequence:CCGGGCATCCTGCAACCTCACTTAGCTCGAGCTAAGTGAGGTTGCAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134126
VALIDATED
IFT140 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 140 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-5024s21c1
Sequence:CCGGGAATACCAGATGGCCTATAAGCTCGAGCTTATAGGCCATCTGGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-1274s21c1
Sequence:CCGGCCACTCCTGAAACACGAATATCTCGAGATATTCGTGTTTCAGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-3020s21c1
Sequence:CCGGATGGAAGTGCCTCACTATTACCTCGAGGTAATAGTGAGGCACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-4055s21c1
Sequence:CCGGATTGAGGCAGCCCGGTATTATCTCGAGATAATACCGGGCTGCCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-5260s21c1
Sequence:CCGGGCATCCTGCAACCTCACTTAGCTCGAGCTAAGTGAGGTTGCAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134126
VALIDATED
IFT140 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 140 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-5024s21c1
Sequence:CCGGGAATACCAGATGGCCTATAAGCTCGAGCTTATAGGCCATCTGGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-1274s21c1
Sequence:CCGGCCACTCCTGAAACACGAATATCTCGAGATATTCGTGTTTCAGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134126.3-3020s21c1
Sequence:CCGGATGGAAGTGCCTCACTATTACCTCGAGGTAATAGTGAGGCACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-4055s21c1
Sequence:CCGGATTGAGGCAGCCCGGTATTATCTCGAGATAATACCGGGCTGCCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134126.3-5260s21c1
Sequence:CCGGGCATCCTGCAACCTCACTTAGCTCGAGCTAAGTGAGGTTGCAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)