EMAIL THIS PAGE TO A FRIEND

IFT172

intraflagellar transport 172 homolog (Chlamydomonas)

68 Gene Product Result for
Synonyms: NPHP17 SLB osm-1 wim
UniProtKB ID: Q9UG01, B2RNU5, Q86X44, Q96HW4, Q9UFJ9, Q9ULP1
Gene ID:
Mouse(67661) intraflagellar transport 172
Rat(116475) intraflagellar transport 172 homolog (Chlamydomonas)
Zebrafish(432389) intraflagellar transport 172
chicken(421983) intraflagellar transport 172 homolog (Chlamydomonas)
cow(100848219) intraflagellar transport 172 homolog (Chlamydomonas)
domestic cat(101096469) intraflagellar transport 172 homolog (Chlamydomonas)
dog(483013) intraflagellar transport 172 homolog (Chlamydomonas)
sheep(101118681) intraflagellar transport 172 homolog (Chlamydomonas)
domestic guinea pig(100734918) intraflagellar transport 172 homolog (Chlamydomonas)
naked mole-rat(101699050) intraflagellar transport 172 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_114272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114272 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015662 Rosetta Predictions human pricing
NM_053792 Rosetta Predictions rat pricing
NM_026298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348283 predicted 2048
2 SASI_Hs01_00217971 predicted 3353
3 SASI_Hs01_00217973 predicted 2743
4 SASI_Hs01_00217974 predicted 1214
5 SASI_Hs01_00217975 predicted 244
6 SASI_Hs01_00217977 predicted 4214
7 SASI_Hs01_00217978 predicted 2657
8 SASI_Hs02_00348284 predicted 3964
9 SASI_Hs02_00348285 predicted 2667
10 SASI_Hs02_00348286 predicted 4342
11 SASI_Hs01_00217969 predicted 1514
12 SASI_Hs01_00217970 predicted 3409
13 SASI_Hs01_00217972 predicted 4383
14 SASI_Hs01_00217976 predicted 4878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108885 predicted 1712
2 SASI_Rn01_00108886 predicted 4254
3 SASI_Rn02_00266598 predicted 1605
4 SASI_Rn02_00266599 predicted 283
5 SASI_Rn01_00108887 predicted 1519
6 SASI_Rn01_00108888 predicted 777
7 SASI_Rn01_00108890 predicted 2781
8 SASI_Rn01_00108891 predicted 3779
9 SASI_Rn01_00108892 predicted 3446
10 SASI_Rn02_00266600 predicted 1548
11 SASI_Rn01_00108884 predicted 2707
12 SASI_Rn01_00108889 predicted 4768
13 SASI_Rn01_00108893 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116687 predicted 2586
2 SASI_Mm01_00116689 predicted 1735
3 SASI_Mm01_00116690 predicted 4262
4 SASI_Mm01_00116691 predicted 2710
5 SASI_Mm01_00116692 predicted 1262
6 SASI_Mm01_00116693 predicted 1537
7 SASI_Mm01_00116694 predicted 4183
8 SASI_Mm01_00116695 predicted 4443
9 SASI_Mm01_00116696 predicted 1894
10 SASI_Mm02_00329997 predicted 2316
11 SASI_Mm01_00116688 predicted 1566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026298
VALIDATED
IFT172 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 172 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-2784s21c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-4704s21c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-4897s21c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-2716s21c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-1736s1c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-4704s1c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-2716s1c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-2784s1c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-4897s1c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-1736s21c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026298
VALIDATED
IFT172 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 172 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-2784s21c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-4704s21c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-4897s21c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-2716s21c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-1736s1c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-4704s1c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-2716s1c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-2784s1c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-4897s1c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-1736s21c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026298
VALIDATED
IFT172 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 172 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-2784s21c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026298.4-4704s21c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-4897s21c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-2716s21c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-1736s1c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-4704s1c1
Sequence:CCGGGCTGCTGATCTCTCATTACTACTCGAGTAGTAATGAGAGATCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026298.4-2716s1c1
Sequence:CCGGGCGGCCATCAACCACTATATTCTCGAGAATATAGTGGTTGATGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-2784s1c1
Sequence:CCGGCCAGTGGAAGAAGGCAATTTACTCGAGTAAATTGCCTTCTTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026298.4-4897s1c1
Sequence:CCGGCGGTTCTTGGATCTGACTGATCTCGAGATCAGTCAGATCCAAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026298.4-1736s21c1
Sequence:CCGGGCTTATGTGTATGGTACAATACTCGAGTATTGTACCATACACATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114272
VALIDATED
IFT172 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 172 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-5079s1c1
Sequence:CCGGGAAGGCTGCTAACAAGGACAACTCGAGTTGTCCTTGTTAGCAGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-329s1c1
Sequence:CCGGCGGCAGAATACATCATTGTCTCTCGAGAGACAATGATGTATTCTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-4693s1c1
Sequence:CCGGGCCTTCTATGAAGCAGGCATTCTCGAGAATGCCTGCTTCATAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-1804s1c1
Sequence:CCGGGCCTTCTTAGAGACTCTGGAACTCGAGTTCCAGAGTCTCTAAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-3328s1c1
Sequence:CCGGGCAGACAATTGCTCCTTTGAACTCGAGTTCAAAGGAGCAATTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-213s1c1
Sequence:CCGGCATAGGACAGACTGACAACATCTCGAGATGTTGTCAGTCTGTCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-100s1c1
Sequence:CCGGGAACATGGAGAACGGAGAGATCTCGAGATCTCTCCGTTCTCCATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-3951s1c1
Sequence:CCGGCCAACGTAATATGGAAGTCGTCTCGAGACGACTTCCATATTACGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114272
VALIDATED
IFT172 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 172 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-5079s1c1
Sequence:CCGGGAAGGCTGCTAACAAGGACAACTCGAGTTGTCCTTGTTAGCAGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-329s1c1
Sequence:CCGGCGGCAGAATACATCATTGTCTCTCGAGAGACAATGATGTATTCTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-4693s1c1
Sequence:CCGGGCCTTCTATGAAGCAGGCATTCTCGAGAATGCCTGCTTCATAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-1804s1c1
Sequence:CCGGGCCTTCTTAGAGACTCTGGAACTCGAGTTCCAGAGTCTCTAAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-3328s1c1
Sequence:CCGGGCAGACAATTGCTCCTTTGAACTCGAGTTCAAAGGAGCAATTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-213s1c1
Sequence:CCGGCATAGGACAGACTGACAACATCTCGAGATGTTGTCAGTCTGTCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-100s1c1
Sequence:CCGGGAACATGGAGAACGGAGAGATCTCGAGATCTCTCCGTTCTCCATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-3951s1c1
Sequence:CCGGCCAACGTAATATGGAAGTCGTCTCGAGACGACTTCCATATTACGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114272
VALIDATED
IFT172 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 172 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-5079s1c1
Sequence:CCGGGAAGGCTGCTAACAAGGACAACTCGAGTTGTCCTTGTTAGCAGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-329s1c1
Sequence:CCGGCGGCAGAATACATCATTGTCTCTCGAGAGACAATGATGTATTCTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-4693s1c1
Sequence:CCGGGCCTTCTATGAAGCAGGCATTCTCGAGAATGCCTGCTTCATAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-1804s1c1
Sequence:CCGGGCCTTCTTAGAGACTCTGGAACTCGAGTTCCAGAGTCTCTAAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-3328s1c1
Sequence:CCGGGCAGACAATTGCTCCTTTGAACTCGAGTTCAAAGGAGCAATTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_114272.4-213s1c1
Sequence:CCGGCATAGGACAGACTGACAACATCTCGAGATGTTGTCAGTCTGTCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-100s1c1
Sequence:CCGGGAACATGGAGAACGGAGAGATCTCGAGATCTCTCCGTTCTCCATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114272.4-3951s1c1
Sequence:CCGGCCAACGTAATATGGAAGTCGTCTCGAGACGACTTCCATATTACGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)