EMAIL THIS PAGE TO A FRIEND

IFT20

intraflagellar transport 20 homolog (Chlamydomonas)

48 Gene Product Result for
UniProtKB ID: Q8IY31, J3QL09, Q5GLZ2, Q9BUG5
Gene ID:
Human(90410) Summary: This gene encodes a intraflagellar transport protein important for intracellular transport. The encoded protein forms part of a complex involved in trafficking of proteins from the Golgi body, including recycling of immune signalling components (Finetti et al., PubMed: 19855387). This gene is part of a complex set of sense-antisense loci that may be co-regulated. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 14.[provided by RefSeq, Jun 2012]
Mouse(55978) intraflagellar transport 20
Rat(287541) intraflagellar transport 20 homolog (Chlamydomonas)
domestic guinea pig(100728521) intraflagellar transport 20 homolog (Chlamydomonas)
naked mole-rat(101703180) intraflagellar transport 20 homolog (Chlamydomonas)
sheep(101103579) intraflagellar transport 20 homolog (Chlamydomonas)
Zebrafish(414930) intraflagellar transport protein 20
cow(445364) intraflagellar transport 20 homolog (Chlamydomonas)
domestic cat(101101517) intraflagellar transport 20 homolog (Chlamydomonas)
dog(480620) intraflagellar transport 20 homolog (Chlamydomonas)
chicken(417671) intraflagellar transport 20 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174887 Rosetta Predictions human pricing
NM_001105815 Rosetta Predictions rat pricing
NM_018854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186053 predicted 572
2 SASI_Hs01_00186054 predicted 568
3 SASI_Hs01_00186055 predicted 198
4 SASI_Hs01_00186056 predicted 468
5 SASI_Hs01_00186057 predicted 729
6 SASI_Hs01_00186058 predicted 729
7 SASI_Hs01_00186059 predicted 867
8 SASI_Hs01_00186060 predicted 849
9 SASI_Hs01_00186061 predicted 751
10 SASI_Hs01_00186062 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212806 predicted 401
2 SASI_Rn02_00212807 predicted 468
3 SASI_Rn02_00212808 predicted 569
4 SASI_Rn02_00212809 predicted 594
5 SASI_Rn02_00212810 predicted 473
6 SASI_Rn02_00212811 predicted 446
7 SASI_Rn02_00212812 predicted 340
8 SASI_Rn02_00212813 predicted 515
9 SASI_Rn02_00212814 predicted 489
10 SASI_Rn02_00212815 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095834 predicted 382
2 SASI_Mm01_00095835 predicted 385
3 SASI_Mm01_00095837 predicted 428
4 SASI_Mm01_00095838 predicted 550
5 SASI_Mm01_00095839 predicted 422
6 SASI_Mm01_00095840 predicted 523
7 SASI_Mm01_00095841 predicted 525
8 SASI_Mm01_00095842 predicted 472
9 SASI_Mm01_00095843 predicted 478
10 SASI_Mm02_00324209 predicted 373
11 SASI_Mm01_00095836 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174887
VALIDATED
IFT20 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 20 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-471s21c1
Sequence:CCGGGTGCTCGGAACTTGCTCAAATCTCGAGATTTGAGCAAGTTCCGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-217s21c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-300s1c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-283s1c1
Sequence:CCGGGTTGGTGGTTTAATTGAGCTTCTCGAGAAGCTCAATTAAACCACCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-300s21c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-520s1c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-557s1c1
Sequence:CCGGCAGCTAGAAAGGTATCGGGTTCTCGAGAACCCGATACCTTTCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-217s1c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174887.2-581s21c1
Sequence:CCGGTATGAAGCTTTGTGTAAAGTACTCGAGTACTTTACACAAAGCTTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-520s21c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174887
VALIDATED
IFT20 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 20 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-471s21c1
Sequence:CCGGGTGCTCGGAACTTGCTCAAATCTCGAGATTTGAGCAAGTTCCGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-217s21c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-300s1c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-283s1c1
Sequence:CCGGGTTGGTGGTTTAATTGAGCTTCTCGAGAAGCTCAATTAAACCACCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-300s21c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-520s1c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-557s1c1
Sequence:CCGGCAGCTAGAAAGGTATCGGGTTCTCGAGAACCCGATACCTTTCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-217s1c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174887.2-581s21c1
Sequence:CCGGTATGAAGCTTTGTGTAAAGTACTCGAGTACTTTACACAAAGCTTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-520s21c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174887
VALIDATED
IFT20 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 20 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-471s21c1
Sequence:CCGGGTGCTCGGAACTTGCTCAAATCTCGAGATTTGAGCAAGTTCCGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-217s21c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-300s1c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-283s1c1
Sequence:CCGGGTTGGTGGTTTAATTGAGCTTCTCGAGAAGCTCAATTAAACCACCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-300s21c1
Sequence:CCGGGCTTGTTGATCAACTTGCAAACTCGAGTTTGCAAGTTGATCAACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-520s1c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-557s1c1
Sequence:CCGGCAGCTAGAAAGGTATCGGGTTCTCGAGAACCCGATACCTTTCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174887.2-217s1c1
Sequence:CCGGCAGACCATAGAGCTGAAGGAACTCGAGTTCCTTCAGCTCTATGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174887.2-581s21c1
Sequence:CCGGTATGAAGCTTTGTGTAAAGTACTCGAGTACTTTACACAAAGCTTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174887.2-520s21c1
Sequence:CCGGGCAGCAACTTCAAGCCCTAATCTCGAGATTAGGGCTTGAAGTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018854
VALIDATED
IFT20 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 20 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-529s21c1
Sequence:CCGGGGTCTAATTGAGCTTGTTGATCTCGAGATCAACAAGCTCAATTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-417s21c1
Sequence:CCGGACTGAACAAGCTCCGAGTGTTCTCGAGAACACTCGGAGCTTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-598s21c1
Sequence:CCGGCGGAACTTGCTGAAGTCCATACTCGAGTATGGACTTCAGCAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-474s21c1
Sequence:CCGGGGAGGAGTGCAAGGACTTTGTCTCGAGACAAAGTCCTTGCACTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-562s21c1
Sequence:CCGGGAAGCAGAGAACGAGAAGATGCTCGAGCATCTTCTCGTTCTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018854
VALIDATED
IFT20 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 20 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-529s21c1
Sequence:CCGGGGTCTAATTGAGCTTGTTGATCTCGAGATCAACAAGCTCAATTAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-417s21c1
Sequence:CCGGACTGAACAAGCTCCGAGTGTTCTCGAGAACACTCGGAGCTTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-598s21c1
Sequence:CCGGCGGAACTTGCTGAAGTCCATACTCGAGTATGGACTTCAGCAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-474s21c1
Sequence:CCGGGGAGGAGTGCAAGGACTTTGTCTCGAGACAAAGTCCTTGCACTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-562s21c1
Sequence:CCGGGAAGCAGAGAACGAGAAGATGCTCGAGCATCTTCTCGTTCTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018854
VALIDATED
IFT20 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 20 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-529s21c1
Sequence:CCGGGGTCTAATTGAGCTTGTTGATCTCGAGATCAACAAGCTCAATTAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-417s21c1
Sequence:CCGGACTGAACAAGCTCCGAGTGTTCTCGAGAACACTCGGAGCTTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-598s21c1
Sequence:CCGGCGGAACTTGCTGAAGTCCATACTCGAGTATGGACTTCAGCAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-474s21c1
Sequence:CCGGGGAGGAGTGCAAGGACTTTGTCTCGAGACAAAGTCCTTGCACTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018854.4-562s21c1
Sequence:CCGGGAAGCAGAGAACGAGAAGATGCTCGAGCATCTTCTCGTTCTCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)