EMAIL THIS PAGE TO A FRIEND

IFT27

intraflagellar transport 27 homolog (Chlamydomonas)

185 Gene Product Result for
Synonyms: RABL4 RAYL
UniProtKB ID: Q9BW83, O60897
Gene ID:
Human(11020) Summary: This gene encodes a GTP-binding protein that is a core component of the intraflagellar transport complex B. Characterization of the similar Chlamydomonas protein indicates a function in cell cycle control. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(67042) intraflagellar transport 27
Rat(300062) intraflagellar transport 27 homolog (Chlamydomonas)
Zebrafish(494045) intraflagellar transport 27 homolog (Chlamydomonas)
cow(617147) intraflagellar transport 27 homolog (Chlamydomonas)
chicken(418053) intraflagellar transport 27 homolog (Chlamydomonas)
dog(474517) intraflagellar transport 27 homolog (Chlamydomonas)
domestic cat(101095028) intraflagellar transport 27 homolog (Chlamydomonas)
sheep(100145882) intraflagellar transport 27 homolog (Chlamydomonas)
domestic guinea pig(100728985) intraflagellar transport 27 homolog (Chlamydomonas)
naked mole-rat(101699915) intraflagellar transport 27 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125711 MISSION® esiRNA esiRNA human RABL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006860 Rosetta Predictions human pricing
NM_001130495 Rosetta Predictions rat pricing
NM_025931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040978 predicted 614
2 SASI_Hs01_00040979 predicted 527
3 SASI_Hs01_00040980 predicted 519
4 SASI_Hs01_00040982 predicted 597
5 SASI_Hs01_00040984 predicted 516
6 SASI_Hs02_00342475 predicted 502
7 SASI_Hs01_00040986 predicted 593
8 SASI_Hs02_00342476 predicted 415
9 SASI_Hs02_00342477 predicted 697
10 SASI_Hs02_00342478 predicted 640
11 SASI_Hs01_00040977 predicted 478
12 SASI_Hs01_00040981 predicted 693
13 SASI_Hs01_00040983 predicted 474
14 SASI_Hs01_00040985 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255379 predicted 555
2 SASI_Rn02_00255380 predicted 732
3 SASI_Rn02_00255381 predicted 609
4 SASI_Rn02_00255382 predicted 521
5 SASI_Rn02_00255383 predicted 736
6 SASI_Rn02_00255384 predicted 411
7 SASI_Rn02_00255385 predicted 427
8 SASI_Rn02_00255386 predicted 410
9 SASI_Rn02_00255387 predicted 537
10 SASI_Rn02_00255388 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110528 predicted 728
2 SASI_Mm01_00110529 predicted 414
3 SASI_Mm01_00110531 predicted 428
4 SASI_Mm01_00110532 predicted 533
5 SASI_Mm01_00110533 predicted 719
6 SASI_Mm01_00110534 predicted 428
7 SASI_Mm01_00110535 predicted 453
8 SASI_Mm01_00110536 predicted 400
9 SASI_Mm01_00110537 predicted 672
10 SASI_Mm02_00329318 predicted 672
11 SASI_Mm01_00110530 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006860
IFT27 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 27 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-497s21c1
Sequence:CCGGTGAAGACAGTGCCAGTTCCTGCTCGAGCAGGAACTGGCACTGTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-591s21c1
Sequence:CCGGATTGTGGGAGAGTCCCAATGTCTCGAGACATTGGGACTCTCCCACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-527s1c1
Sequence:CCGGACAGTGTGGAACTCTTCATTTCTCGAGAAATGAAGAGTTCCACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-605s1c1
Sequence:CCGGCCAATGTCTTATGTCTCGTCTCTCGAGAGACGAGACATAAGACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-619s1c1
Sequence:CCGGCTCGTCTATGATGTGACCAATCTCGAGATTGGTCACATCATAGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-470s1c1
Sequence:CCGGCCCTGACAACAGGAATGGATTCTCGAGAATCCATTCCTGTTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-424s21c1
Sequence:CCGGGCACAGATCTTCCGCAGTGATCTCGAGATCACTGCGGAAGATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-815s1c1
Sequence:CCGGCATCCGTGAAAGAGATGGAAACTCGAGTTTCCATCTCTTTCACGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-573s21c1
Sequence:CCGGTTCGGAAATGCTGGATAAATTCTCGAGAATTTATCCAGCATTTCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006860
IFT27 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 27 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-497s21c1
Sequence:CCGGTGAAGACAGTGCCAGTTCCTGCTCGAGCAGGAACTGGCACTGTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-591s21c1
Sequence:CCGGATTGTGGGAGAGTCCCAATGTCTCGAGACATTGGGACTCTCCCACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-527s1c1
Sequence:CCGGACAGTGTGGAACTCTTCATTTCTCGAGAAATGAAGAGTTCCACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-605s1c1
Sequence:CCGGCCAATGTCTTATGTCTCGTCTCTCGAGAGACGAGACATAAGACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-619s1c1
Sequence:CCGGCTCGTCTATGATGTGACCAATCTCGAGATTGGTCACATCATAGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-470s1c1
Sequence:CCGGCCCTGACAACAGGAATGGATTCTCGAGAATCCATTCCTGTTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-424s21c1
Sequence:CCGGGCACAGATCTTCCGCAGTGATCTCGAGATCACTGCGGAAGATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-815s1c1
Sequence:CCGGCATCCGTGAAAGAGATGGAAACTCGAGTTTCCATCTCTTTCACGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-573s21c1
Sequence:CCGGTTCGGAAATGCTGGATAAATTCTCGAGAATTTATCCAGCATTTCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006860
IFT27 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 27 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-497s21c1
Sequence:CCGGTGAAGACAGTGCCAGTTCCTGCTCGAGCAGGAACTGGCACTGTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-591s21c1
Sequence:CCGGATTGTGGGAGAGTCCCAATGTCTCGAGACATTGGGACTCTCCCACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-527s1c1
Sequence:CCGGACAGTGTGGAACTCTTCATTTCTCGAGAAATGAAGAGTTCCACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-605s1c1
Sequence:CCGGCCAATGTCTTATGTCTCGTCTCTCGAGAGACGAGACATAAGACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-619s1c1
Sequence:CCGGCTCGTCTATGATGTGACCAATCTCGAGATTGGTCACATCATAGACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-470s1c1
Sequence:CCGGCCCTGACAACAGGAATGGATTCTCGAGAATCCATTCCTGTTGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-424s21c1
Sequence:CCGGGCACAGATCTTCCGCAGTGATCTCGAGATCACTGCGGAAGATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006860.2-815s1c1
Sequence:CCGGCATCCGTGAAAGAGATGGAAACTCGAGTTTCCATCTCTTTCACGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006860.2-573s21c1
Sequence:CCGGTTCGGAAATGCTGGATAAATTCTCGAGAATTTATCCAGCATTTCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025931
VALIDATED
IFT27 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 27 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-743s21c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-449s21c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-564s21c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025931.2-529s1c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-879s1c1
Sequence:CCGGACTGTCCTGAAGGGCTGCCCACTCGAGTGGGCAGCCCTTCAGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-743s1c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-564s1c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-449s1c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-529s21c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025931
VALIDATED
IFT27 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 27 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-743s21c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-449s21c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-564s21c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025931.2-529s1c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-879s1c1
Sequence:CCGGACTGTCCTGAAGGGCTGCCCACTCGAGTGGGCAGCCCTTCAGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-743s1c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-564s1c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-449s1c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-529s21c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025931
VALIDATED
IFT27 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 27 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-743s21c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-449s21c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-564s21c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025931.2-529s1c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-879s1c1
Sequence:CCGGACTGTCCTGAAGGGCTGCCCACTCGAGTGGGCAGCCCTTCAGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-743s1c1
Sequence:CCGGGCCTGGAATTCTTTGAGACATCTCGAGATGTCTCAAAGAATTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-564s1c1
Sequence:CCGGCCTTGTCTATGATGTGACCAACTCGAGTTGGTCACATCATAGACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025931.2-449s1c1
Sequence:CCGGCAGTGCCAGTTCTTGACACAACTCGAGTTGTGTCAAGAACTGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025931.2-529s21c1
Sequence:CCGGCTGGATAAGTTGTGGGAGAATCTCGAGATTCTCCCACAACTTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)