EMAIL THIS PAGE TO A FRIEND

IFT46

intraflagellar transport 46 homolog (Chlamydomonas)

59 Gene Product Result for
Synonyms: C11orf2 C11orf60
UniProtKB ID: Q9NQC8, A8K0F6, Q9H6V5
Gene ID:
Mouse(76568) intraflagellar transport 46
Rat(300675) intraflagellar transport 46 homolog (Chlamydomonas)
Zebrafish(565922) intraflagellar transport protein 46
cow(505579) intraflagellar transport 46 homolog (Chlamydomonas)
domestic cat(101091556) intraflagellar transport 46 homolog (Chlamydomonas)
dog(479416) intraflagellar transport 46 homolog (Chlamydomonas)
chicken(419780) intraflagellar transport 46 homolog (Chlamydomonas)
sheep(101102172) intraflagellar transport 46 homolog (Chlamydomonas)
domestic guinea pig(100726952) intraflagellar transport 46 homolog (Chlamydomonas)
naked mole-rat(101717235) intraflagellar transport 46 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020153 Rosetta Predictions human pricing
NM_001024760 Rosetta Predictions rat pricing
NM_023831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245452 predicted 908
2 SASI_Hs01_00245454 predicted 899
3 SASI_Hs01_00245455 predicted 924
4 SASI_Hs01_00245456 predicted 1502
5 SASI_Hs01_00245457 predicted 1488
6 SASI_Hs01_00245458 predicted 1247
7 SASI_Hs01_00245459 predicted 1002
8 SASI_Hs01_00245460 predicted 974
9 SASI_Hs01_00245461 predicted 1081
10 SASI_Hs02_00353048 predicted 1061
11 SASI_Hs01_00245453 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110532 predicted 1038
2 SASI_Rn02_00202639 predicted 789
3 SASI_Rn01_00110533 predicted 588
4 SASI_Rn01_00110534 predicted 515
5 SASI_Rn01_00110535 predicted 807
6 SASI_Rn01_00110536 predicted 557
7 SASI_Rn01_00110537 predicted 766
8 SASI_Rn01_00110538 predicted 1286
9 SASI_Rn01_00110539 predicted 865
10 SASI_Rn01_00110540 predicted 1228
11 SASI_Rn01_00110541 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120420 predicted 1018
2 SASI_Mm02_00327381 predicted 1513
3 SASI_Mm01_00120421 predicted 1209
4 SASI_Mm01_00120422 predicted 1481
5 SASI_Mm01_00120423 predicted 996
6 SASI_Mm01_00120424 predicted 1175
7 SASI_Mm01_00120425 predicted 1463
8 SASI_Mm01_00120426 predicted 1604
9 SASI_Mm02_00327382 predicted 1536
10 SASI_Mm01_00120428 predicted 1611
11 SASI_Mm01_00120427 predicted 746
12 SASI_Mm01_00120429 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020153
VALIDATED
IFT46 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 46 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-1423s21c1
Sequence:CCGGCATTCACTCCTTCATCCAATTCTCGAGAATTGGATGAAGGAGTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-692s21c1
Sequence:CCGGTGATTCATCTGAAACTGATTCCTCGAGGAATCAGTTTCAGATGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-776s21c1
Sequence:CCGGCTATGAGCATTTGCCAGTTTCCTCGAGGAAACTGGCAAATGCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1085s1c1
Sequence:CCGGGCATCTCTGAATTACACCGTTCTCGAGAACGGTGTAATTCAGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020153.2-1595s1c1
Sequence:CCGGGCACAGAACATGTTTGTTTAACTCGAGTTAAACAAACATGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1236s1c1
Sequence:CCGGCCTGGCAGAGTACATTGACATCTCGAGATGTCAATGTACTCTGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-819s1c1
Sequence:CCGGCCACAAACTGAAGCCTTTCATCTCGAGATGAAAGGCTTCAGTTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-1088s1c1
Sequence:CCGGTCTCTGAATTACACCGTTCTACTCGAGTAGAACGGTGTAATTCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020153
VALIDATED
IFT46 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 46 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-1423s21c1
Sequence:CCGGCATTCACTCCTTCATCCAATTCTCGAGAATTGGATGAAGGAGTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-692s21c1
Sequence:CCGGTGATTCATCTGAAACTGATTCCTCGAGGAATCAGTTTCAGATGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-776s21c1
Sequence:CCGGCTATGAGCATTTGCCAGTTTCCTCGAGGAAACTGGCAAATGCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1085s1c1
Sequence:CCGGGCATCTCTGAATTACACCGTTCTCGAGAACGGTGTAATTCAGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020153.2-1595s1c1
Sequence:CCGGGCACAGAACATGTTTGTTTAACTCGAGTTAAACAAACATGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1236s1c1
Sequence:CCGGCCTGGCAGAGTACATTGACATCTCGAGATGTCAATGTACTCTGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-819s1c1
Sequence:CCGGCCACAAACTGAAGCCTTTCATCTCGAGATGAAAGGCTTCAGTTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-1088s1c1
Sequence:CCGGTCTCTGAATTACACCGTTCTACTCGAGTAGAACGGTGTAATTCAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020153
VALIDATED
IFT46 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 46 homolog (Chlamydomonas)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-1423s21c1
Sequence:CCGGCATTCACTCCTTCATCCAATTCTCGAGAATTGGATGAAGGAGTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-692s21c1
Sequence:CCGGTGATTCATCTGAAACTGATTCCTCGAGGAATCAGTTTCAGATGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020153.3-776s21c1
Sequence:CCGGCTATGAGCATTTGCCAGTTTCCTCGAGGAAACTGGCAAATGCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1085s1c1
Sequence:CCGGGCATCTCTGAATTACACCGTTCTCGAGAACGGTGTAATTCAGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020153.2-1595s1c1
Sequence:CCGGGCACAGAACATGTTTGTTTAACTCGAGTTAAACAAACATGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_020153.2-1236s1c1
Sequence:CCGGCCTGGCAGAGTACATTGACATCTCGAGATGTCAATGTACTCTGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-819s1c1
Sequence:CCGGCCACAAACTGAAGCCTTTCATCTCGAGATGAAAGGCTTCAGTTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020153.2-1088s1c1
Sequence:CCGGTCTCTGAATTACACCGTTCTACTCGAGTAGAACGGTGTAATTCAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023831
VALIDATED
IFT46 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 46 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-756s21c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-993s21c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-515s1c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-1026s21c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-514s21c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023831.2-1223s1c1
Sequence:CCGGGCTTCAAAGTTAGATGAAGATCTCGAGATCTTCATCTAACTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-994s1c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-757s1c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-1027s1c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023831
VALIDATED
IFT46 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 46 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-756s21c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-993s21c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-515s1c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-1026s21c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-514s21c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023831.2-1223s1c1
Sequence:CCGGGCTTCAAAGTTAGATGAAGATCTCGAGATCTTCATCTAACTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-994s1c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-757s1c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-1027s1c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023831
VALIDATED
IFT46 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 46 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-756s21c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-993s21c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-515s1c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-1026s21c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023831.3-514s21c1
Sequence:CCGGGCCGAGATCAAGGAGCTCTTTCTCGAGAAAGAGCTCCTTGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023831.2-1223s1c1
Sequence:CCGGGCTTCAAAGTTAGATGAAGATCTCGAGATCTTCATCTAACTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-994s1c1
Sequence:CCGGCCTGGCTGAGTACATTGACATCTCGAGATGTCAATGTACTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-757s1c1
Sequence:CCGGGCAGCATAATATTACGCAACACTCGAGTGTTGCGTAATATTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023831.2-1027s1c1
Sequence:CCGGCCTGGACATTCCTTTCTATAACTCGAGTTATAGAAAGGAATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)