EMAIL THIS PAGE TO A FRIEND

IFT52

intraflagellar transport 52 homolog (Chlamydomonas)

45 Gene Product Result for
Synonyms: C20orf9 CGI-53 NGD2 NGD5 dJ1028D15.1
Gene ID:
Mouse(245866) intraflagellar transport 52
Rat(362265) intraflagellar transport 52 homolog (Chlamydomonas)
domestic guinea pig(100719496) intraflagellar transport 52 homolog (Chlamydomonas)
naked mole-rat(101716194) intraflagellar transport 52 homolog (Chlamydomonas)
sheep(101107376) intraflagellar transport 52 homolog (Chlamydomonas)
Zebrafish(414931) intraflagellar transport protein 52
chicken(419165) intraflagellar transport 52 homolog (Chlamydomonas)
dog(610842) intraflagellar transport 52 homolog (Chlamydomonas)
cow(513908) intraflagellar transport 52 homolog (Chlamydomonas)
Horse(100055842) intraflagellar transport 52 homolog (Chlamydomonas)
domestic cat(101095486) intraflagellar transport 52 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067423 Anti-IFT52 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016004 Rosetta Predictions human pricing
XM_342571 Rosetta Predictions rat pricing
NM_172150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348683 predicted 1229
2 SASI_Hs01_00146013 predicted 1271
3 SASI_Hs01_00146014 predicted 962
4 SASI_Hs01_00146015 predicted 1189
5 SASI_Hs01_00146016 predicted 516
6 SASI_Hs01_00146017 predicted 917
7 SASI_Hs01_00146018 predicted 717
8 SASI_Hs01_00146019 predicted 1406
9 SASI_Hs01_00146021 predicted 879
10 SASI_Hs01_00146022 predicted 1273
11 SASI_Hs01_00146020 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173837 predicted 454
2 SASI_Rn01_00173838 predicted 390
3 SASI_Rn01_00173839 predicted 802
4 SASI_Rn01_00173840 predicted 578
5 SASI_Rn01_00173841 predicted 349
6 SASI_Rn01_00173842 predicted 261
7 SASI_Rn01_00173843 predicted 409
8 SASI_Rn01_00173844 predicted 658
9 SASI_Rn01_00173845 predicted 719
10 SASI_Rn01_00173846 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169332 predicted 386
2 SASI_Mm01_00169333 predicted 1255
3 SASI_Mm01_00169334 predicted 1179
4 SASI_Mm01_00169335 predicted 793
5 SASI_Mm01_00169336 predicted 997
6 SASI_Mm01_00169337 predicted 938
7 SASI_Mm01_00169338 predicted 403
8 SASI_Mm01_00169339 predicted 430
9 SASI_Mm01_00169340 predicted 924
10 SASI_Mm01_00169341 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016004
VALIDATED
IFT52 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 52 homolog (Chlamydomonas)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1165s21c1
Sequence:CCGGCTCCTCCTCTGGAGCTATTTGCTCGAGCAAATAGCTCCAGAGGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-435s21c1
Sequence:CCGGGAATATGGAATCATGGTTAATCTCGAGATTAACCATGATTCCATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1438s21c1
Sequence:CCGGGACCATGCCTCTTGAAGCTTTCTCGAGAAAGCTTCAAGAGGCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-770s21c1
Sequence:CCGGTCACATGTTCAGTGATCAATACTCGAGTATTGATCACTGAACATGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-401s21c1
Sequence:CCGGCAGATTTGACACCAATATTAACTCGAGTTAATATTGGTGTCAAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016004
VALIDATED
IFT52 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 52 homolog (Chlamydomonas)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1165s21c1
Sequence:CCGGCTCCTCCTCTGGAGCTATTTGCTCGAGCAAATAGCTCCAGAGGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-435s21c1
Sequence:CCGGGAATATGGAATCATGGTTAATCTCGAGATTAACCATGATTCCATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1438s21c1
Sequence:CCGGGACCATGCCTCTTGAAGCTTTCTCGAGAAAGCTTCAAGAGGCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-770s21c1
Sequence:CCGGTCACATGTTCAGTGATCAATACTCGAGTATTGATCACTGAACATGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-401s21c1
Sequence:CCGGCAGATTTGACACCAATATTAACTCGAGTTAATATTGGTGTCAAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016004
VALIDATED
IFT52 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 52 homolog (Chlamydomonas)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1165s21c1
Sequence:CCGGCTCCTCCTCTGGAGCTATTTGCTCGAGCAAATAGCTCCAGAGGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-435s21c1
Sequence:CCGGGAATATGGAATCATGGTTAATCTCGAGATTAACCATGATTCCATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-1438s21c1
Sequence:CCGGGACCATGCCTCTTGAAGCTTTCTCGAGAAAGCTTCAAGAGGCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-770s21c1
Sequence:CCGGTCACATGTTCAGTGATCAATACTCGAGTATTGATCACTGAACATGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016004.2-401s21c1
Sequence:CCGGCAGATTTGACACCAATATTAACTCGAGTTAATATTGGTGTCAAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172150
VALIDATED
IFT52 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 52 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1651s1c1
Sequence:CCGGGCTGTTTGTGTCAGAACCTATCTCGAGATAGGTTCTGACACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1889s1c1
Sequence:CCGGGCTCATCTGGAACATGATATTCTCGAGAATATCATGTTCCAGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-123s1c1
Sequence:CCGGGTTTACCACCAACACTGGCTACTCGAGTAGCCAGTGTTGGTGGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-199s1c1
Sequence:CCGGGAAATCACTTCTGAGAAGTTACTCGAGTAACTTCTCAGAAGTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1258s1c1
Sequence:CCGGCTTCCAAAGGATCAACAGGATCTCGAGATCCTGTTGATCCTTTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172150
VALIDATED
IFT52 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 52 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1651s1c1
Sequence:CCGGGCTGTTTGTGTCAGAACCTATCTCGAGATAGGTTCTGACACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1889s1c1
Sequence:CCGGGCTCATCTGGAACATGATATTCTCGAGAATATCATGTTCCAGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-123s1c1
Sequence:CCGGGTTTACCACCAACACTGGCTACTCGAGTAGCCAGTGTTGGTGGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-199s1c1
Sequence:CCGGGAAATCACTTCTGAGAAGTTACTCGAGTAACTTCTCAGAAGTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1258s1c1
Sequence:CCGGCTTCCAAAGGATCAACAGGATCTCGAGATCCTGTTGATCCTTTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172150
VALIDATED
IFT52 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 52 homolog (Chlamydomonas)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1651s1c1
Sequence:CCGGGCTGTTTGTGTCAGAACCTATCTCGAGATAGGTTCTGACACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1889s1c1
Sequence:CCGGGCTCATCTGGAACATGATATTCTCGAGAATATCATGTTCCAGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-123s1c1
Sequence:CCGGGTTTACCACCAACACTGGCTACTCGAGTAGCCAGTGTTGGTGGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-199s1c1
Sequence:CCGGGAAATCACTTCTGAGAAGTTACTCGAGTAACTTCTCAGAAGTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172150.2-1258s1c1
Sequence:CCGGCTTCCAAAGGATCAACAGGATCTCGAGATCCTGTTGATCCTTTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)