EMAIL THIS PAGE TO A FRIEND

IFT57

intraflagellar transport 57 homolog (Chlamydomonas)

139 Gene Product Result for
Synonyms: ESRRBL1 HIPPI MHS4R2
UniProtKB ID: Q9NWB7, Q96DA9
Gene ID:
Mouse(73916) intraflagellar transport 57
Rat(303968) intraflagellar transport 57 homolog (Chlamydomonas)
Zebrafish(414929) intraflagellar transport protein 57
chicken(418409) intraflagellar transport 57 homolog (Chlamydomonas)
domestic cat(101080991) intraflagellar transport 57 homolog (Chlamydomonas)
cow(531436) intraflagellar transport 57 homolog (Chlamydomonas)
dog(478553) intraflagellar transport 57 homolog (Chlamydomonas)
sheep(101111421) intraflagellar transport 57 homolog (Chlamydomonas)
Domestic Rabbit(100354301) intraflagellar transport 57 homolog (Chlamydomonas)
domestic guinea pig(100728048) intraflagellar transport 57 homolog (Chlamydomonas)
naked mole-rat(101711942) intraflagellar transport 57 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018010 Rosetta Predictions human pricing
NM_001107093 Rosetta Predictions rat pricing
NM_028680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141548 predicted 976
2 SASI_Hs01_00141549 predicted 1480
3 SASI_Hs01_00141550 predicted 1357
4 SASI_Hs01_00141552 predicted 542
5 SASI_Hs01_00141553 predicted 855
6 SASI_Hs01_00141554 predicted 1178
7 SASI_Hs01_00141555 predicted 1060
8 SASI_Hs02_00351091 predicted 1026
9 SASI_Hs02_00351092 predicted 1286
10 SASI_Hs01_00141557 predicted 741
11 SASI_Hs01_00141551 predicted 530
12 SASI_Hs01_00141556 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225426 predicted 583
2 SASI_Rn02_00225427 predicted 683
3 SASI_Rn02_00225428 predicted 1404
4 SASI_Rn02_00225429 predicted 650
5 SASI_Rn02_00225430 predicted 1155
6 SASI_Rn02_00225431 predicted 857
7 SASI_Rn02_00225432 predicted 359
8 SASI_Rn02_00225433 predicted 1195
9 SASI_Rn02_00225434 predicted 1397
10 SASI_Rn02_00225435 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117441 predicted 798
2 SASI_Mm01_00117442 predicted 587
3 SASI_Mm01_00117443 predicted 477
4 SASI_Mm02_00334238 predicted 684
5 SASI_Mm01_00117444 predicted 1087
6 SASI_Mm01_00117445 predicted 655
7 SASI_Mm01_00117446 predicted 1341
8 SASI_Mm01_00117447 predicted 1393
9 SASI_Mm01_00117448 predicted 774
10 SASI_Mm01_00117449 predicted 338
11 SASI_Mm01_00117450 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018010
VALIDATED
IFT57 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 57 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-715s1c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-820s1c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-613s1c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018010.2-1189s1c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-408s1c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-990s21c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-885s21c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-578s21c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-1359s21c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-783s21c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018010
VALIDATED
IFT57 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 57 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-715s1c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-820s1c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-613s1c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018010.2-1189s1c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-408s1c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-990s21c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-885s21c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-578s21c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-1359s21c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-783s21c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018010
VALIDATED
IFT57 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 57 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-715s1c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-820s1c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-613s1c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018010.2-1189s1c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018010.2-408s1c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-990s21c1
Sequence:CCGGCCGCAACTGAAAGTCACGATTCTCGAGAATCGTGACTTTCAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_018010.3-885s21c1
Sequence:CCGGGCCCAGACATATCACTTGGATCTCGAGATCCAAGTGATATGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-578s21c1
Sequence:CCGGCCCTAATGCAACAATATCTAACTCGAGTTAGATATTGTTGCATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-1359s21c1
Sequence:CCGGGCTCCTTTGGTGAAGATTAAACTCGAGTTTAATCTTCACCAAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018010.3-783s21c1
Sequence:CCGGGCAGAAGATGATGCAGAATTACTCGAGTAATTCTGCATCATCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028680
VALIDATED
IFT57 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 57 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028680.2-2090s1c1
Sequence:CCGGGCATTATTGAAGAGTAGCTTTCTCGAGAAAGCTACTCTTCAATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-1153s1c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-975s1c1
Sequence:CCGGCTTGAGCACTTGGTTCAAGAACTCGAGTTCTTGAACCAAGTGCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-591s1c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028680.2-787s1c1
Sequence:CCGGCGCAGCTGAAAGTCACGATTACTCGAGTAATCGTGACTTTCAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-799s21c1
Sequence:CCGGTCACGATTAGGACTGACAATACTCGAGTATTGTCAGTCCTAATCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028680.3-369s21c1
Sequence:CCGGGACGATCCCAATGCAACTATACTCGAGTATAGTTGCATTGGGATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1153s21c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-591s21c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1417s21c1
Sequence:CCGGTATACTTCTTCAAGCATATTCCTCGAGGAATATGCTTGAAGAAGTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028680
VALIDATED
IFT57 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 57 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028680.2-2090s1c1
Sequence:CCGGGCATTATTGAAGAGTAGCTTTCTCGAGAAAGCTACTCTTCAATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-1153s1c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-975s1c1
Sequence:CCGGCTTGAGCACTTGGTTCAAGAACTCGAGTTCTTGAACCAAGTGCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-591s1c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028680.2-787s1c1
Sequence:CCGGCGCAGCTGAAAGTCACGATTACTCGAGTAATCGTGACTTTCAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-799s21c1
Sequence:CCGGTCACGATTAGGACTGACAATACTCGAGTATTGTCAGTCCTAATCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028680.3-369s21c1
Sequence:CCGGGACGATCCCAATGCAACTATACTCGAGTATAGTTGCATTGGGATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1153s21c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-591s21c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1417s21c1
Sequence:CCGGTATACTTCTTCAAGCATATTCCTCGAGGAATATGCTTGAAGAAGTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028680
VALIDATED
IFT57 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 57 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028680.2-2090s1c1
Sequence:CCGGGCATTATTGAAGAGTAGCTTTCTCGAGAAAGCTACTCTTCAATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-1153s1c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-975s1c1
Sequence:CCGGCTTGAGCACTTGGTTCAAGAACTCGAGTTCTTGAACCAAGTGCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028680.2-591s1c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028680.2-787s1c1
Sequence:CCGGCGCAGCTGAAAGTCACGATTACTCGAGTAATCGTGACTTTCAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-799s21c1
Sequence:CCGGTCACGATTAGGACTGACAATACTCGAGTATTGTCAGTCCTAATCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028680.3-369s21c1
Sequence:CCGGGACGATCCCAATGCAACTATACTCGAGTATAGTTGCATTGGGATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1153s21c1
Sequence:CCGGGCACTCCTTTGGTGAAGATTACTCGAGTAATCTTCACCAAAGGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-591s21c1
Sequence:CCGGGCCGAGTTAACATTAAGTAAACTCGAGTTTACTTAATGTTAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028680.3-1417s21c1
Sequence:CCGGTATACTTCTTCAAGCATATTCCTCGAGGAATATGCTTGAAGAAGTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)