EMAIL THIS PAGE TO A FRIEND

IFT74

intraflagellar transport 74 homolog (Chlamydomonas)

94 Gene Product Result for
Synonyms: CCDC2 CMG-1 CMG1
UniProtKB ID: Q96LB3, Q3B789, Q5VY34, Q6PGQ8, Q9H643, Q9H8G7
Gene ID:
Mouse(67694) intraflagellar transport 74
Rat(313365) intraflagellar transport 74 homolog (Chlamydomonas)
domestic guinea pig(100735877) intraflagellar transport 74 homolog (Chlamydomonas)
naked mole-rat(101710134) intraflagellar transport 74 homolog (Chlamydomonas)
sheep(101110029) intraflagellar transport 74 homolog (Chlamydomonas)
chicken(427367) intraflagellar transport 74 homolog (Chlamydomonas)
cow(514024) intraflagellar transport 74 homolog (Chlamydomonas)
Horse(100066944) intraflagellar transport 74 homolog (Chlamydomonas)
domestic cat(101093306) intraflagellar transport 74 homolog (Chlamydomonas)
dog(474734) intraflagellar transport 74 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099222 Rosetta Predictions human pricing
NM_001099223 Rosetta Predictions human pricing
NM_001099224 Rosetta Predictions human pricing
NM_025103 Rosetta Predictions human pricing
NM_001007001 Rosetta Predictions rat pricing
NM_026319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320239 predicted 530
2 SASI_Hs02_00320240 predicted 893
3 SASI_Hs02_00320241 predicted 537
4 SASI_Hs02_00320242 predicted 730
5 SASI_Hs02_00320243 predicted 600
6 SASI_Hs02_00320244 predicted 716
7 SASI_Hs02_00320245 predicted 669
8 SASI_Hs02_00320246 predicted 851
9 SASI_Hs02_00320247 predicted 799
10 SASI_Hs02_00320248 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320249 predicted 491
2 SASI_Hs02_00320250 predicted 851
3 SASI_Hs02_00320251 predicted 498
4 SASI_Hs02_00320252 predicted 680
5 SASI_Hs02_00320253 predicted 552
6 SASI_Hs02_00320254 predicted 673
7 SASI_Hs02_00320255 predicted 627
8 SASI_Hs02_00320256 predicted 804
9 SASI_Hs02_00320257 predicted 763
10 SASI_Hs02_00320258 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320259 predicted 519
2 SASI_Hs02_00320260 predicted 881
3 SASI_Hs02_00320261 predicted 531
4 SASI_Hs02_00320262 predicted 718
5 SASI_Hs02_00320263 predicted 595
6 SASI_Hs02_00320264 predicted 709
7 SASI_Hs02_00320265 predicted 655
8 SASI_Hs02_00320266 predicted 836
9 SASI_Hs02_00320267 predicted 790
10 SASI_Hs02_00320268 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357798 predicted 527
2 SASI_Hs01_00054952 predicted 882
3 SASI_Hs02_00357799 predicted 529
4 SASI_Hs02_00357800 predicted 719
5 SASI_Hs02_00357801 predicted 597
6 SASI_Hs01_00054957 predicted 709
7 SASI_Hs02_00357802 predicted 663
8 SASI_Hs02_00357803 predicted 835
9 SASI_Hs02_00357804 predicted 796
10 SASI_Hs02_00357805 predicted 574
11 SASI_Hs01_00054953 predicted 1764
12 SASI_Hs01_00054954 predicted 1142
13 SASI_Hs01_00054955 predicted 1427
14 SASI_Hs01_00054956 predicted 1291
15 SASI_Hs01_00054958 predicted 1368
16 SASI_Hs01_00054959 predicted 1494
17 SASI_Hs01_00054960 predicted 1419
18 SASI_Hs01_00054961 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065904 predicted 1051
2 SASI_Rn01_00065905 predicted 582
3 SASI_Rn01_00065906 predicted 1844
4 SASI_Rn02_00198587 predicted 411
5 SASI_Rn02_00198588 predicted 884
6 SASI_Rn01_00065907 predicted 1159
7 SASI_Rn01_00065909 predicted 1520
8 SASI_Rn01_00065910 predicted 1307
9 SASI_Rn01_00065911 predicted 603
10 SASI_Rn01_00065912 predicted 979
11 SASI_Rn01_00065908 predicted 1336
12 SASI_Rn01_00065913 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330024 predicted 690
2 SASI_Mm01_00196127 predicted 1058
3 SASI_Mm02_00330025 predicted 550
4 SASI_Mm02_00330026 predicted 610
5 SASI_Mm01_00196130 predicted 1320
6 SASI_Mm01_00196131 predicted 1851
7 SASI_Mm01_00196133 predicted 1164
8 SASI_Mm02_00330027 predicted 642
9 SASI_Mm01_00196136 predicted 1289
10 SASI_Mm02_00330028 predicted 991
11 SASI_Mm01_00196128 predicted 728
12 SASI_Mm01_00196129 predicted 210
13 SASI_Mm01_00196132 predicted 204
14 SASI_Mm01_00196134 predicted 475
15 SASI_Mm01_00196135 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026319
VALIDATED
IFT74 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 74 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-1093s1c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026319.1-100s1c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-145s1c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-454s1c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-851s1c1
Sequence:CCGGCCTCAGATTATGATACCCTTACTCGAGTAAGGGTATCATAATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1009s21c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-964s21c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026319.2-1957s21c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1318s21c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026319.2-1858s21c1
Sequence:CCGGGATTACCAGCCGGTGATTAAACTCGAGTTTAATCACCGGCTGGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026319
VALIDATED
IFT74 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 74 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-1093s1c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026319.1-100s1c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-145s1c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-454s1c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-851s1c1
Sequence:CCGGCCTCAGATTATGATACCCTTACTCGAGTAAGGGTATCATAATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1009s21c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-964s21c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026319.2-1957s21c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1318s21c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026319.2-1858s21c1
Sequence:CCGGGATTACCAGCCGGTGATTAAACTCGAGTTTAATCACCGGCTGGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026319
VALIDATED
IFT74 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 74 homolog (Chlamydomonas)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-1093s1c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026319.1-100s1c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-145s1c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-454s1c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026319.1-851s1c1
Sequence:CCGGCCTCAGATTATGATACCCTTACTCGAGTAAGGGTATCATAATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1009s21c1
Sequence:CCGGCGAGATCAAATGATTGCAGAACTCGAGTTCTGCAATCATTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-964s21c1
Sequence:CCGGGAGGCTGTATTGCTGTATGAACTCGAGTTCATACAGCAATACAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026319.2-1957s21c1
Sequence:CCGGGCCGACTGAGTCTACAAGCATCTCGAGATGCTTGTAGACTCAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026319.2-1318s21c1
Sequence:CCGGGCCAGCATCATCACACTGTTACTCGAGTAACAGTGTGATGATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026319.2-1858s21c1
Sequence:CCGGGATTACCAGCCGGTGATTAAACTCGAGTTTAATCACCGGCTGGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025103
VALIDATED
IFT74 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 74 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-1829s1c1
Sequence:CCGGGAGAGTGATTACCAGCCAATTCTCGAGAATTGGCTGGTAATCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-699s1c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-722s1c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-736s1c1
Sequence:CCGGCGAAGAAGAAATTGAACAGGACTCGAGTCCTGTTCAATTTCTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1555s1c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1271s1c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025103.2-761s21c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-738s21c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1310s21c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1594s21c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025103
VALIDATED
IFT74 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 74 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-1829s1c1
Sequence:CCGGGAGAGTGATTACCAGCCAATTCTCGAGAATTGGCTGGTAATCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-699s1c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-722s1c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-736s1c1
Sequence:CCGGCGAAGAAGAAATTGAACAGGACTCGAGTCCTGTTCAATTTCTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1555s1c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1271s1c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025103.2-761s21c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-738s21c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1310s21c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1594s21c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025103
VALIDATED
IFT74 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 74 homolog (Chlamydomonas)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-1829s1c1
Sequence:CCGGGAGAGTGATTACCAGCCAATTCTCGAGAATTGGCTGGTAATCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-699s1c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-722s1c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025103.1-736s1c1
Sequence:CCGGCGAAGAAGAAATTGAACAGGACTCGAGTCCTGTTCAATTTCTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1555s1c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_025103.1-1271s1c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025103.2-761s21c1
Sequence:CCGGCAAATCAGAAGTGTCGAAGAACTCGAGTTCTTCGACACTTCTGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-738s21c1
Sequence:CCGGCTGAAAGACAAGCGAAAGAAACTCGAGTTTCTTTCGCTTGTCTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1310s21c1
Sequence:CCGGCTGAAACGAAAGGCACAGATACTCGAGTATCTGTGCCTTTCGTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_025103.2-1594s21c1
Sequence:CCGGGACAACTGATCTGGAGATATACTCGAGTATATCTCCAGATCAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)