EMAIL THIS PAGE TO A FRIEND

IFT80

intraflagellar transport 80 homolog (Chlamydomonas)

69 Gene Product Result for
Synonyms: ATD2 WDR56
UniProtKB ID: Q9P2H3, B4E0K1, C9J8I0, Q3MJC4, Q86YF4, Q9UIX1
Gene ID:
Human(57560) Summary: The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
Mouse(68259) intraflagellar transport 80
Rat(295106) intraflagellar transport 80 homolog (Chlamydomonas)
Zebrafish(494082) intraflagellar transport 80 homolog (Chlamydomonas)
cow(513583) intraflagellar transport 80 homolog (Chlamydomonas)
Horse(100049959) intraflagellar transport 80 homolog (Chlamydomonas)
domestic cat(101093957) intraflagellar transport 80 homolog (Chlamydomonas)
dog(488132) intraflagellar transport 80 homolog (Chlamydomonas)
chicken(425014) intraflagellar transport 80 homolog (Chlamydomonas)
sheep(101106299) intraflagellar transport 80 homolog (Chlamydomonas)
domestic guinea pig(100731874) intraflagellar transport 80 homolog (Chlamydomonas)
naked mole-rat(101702438) intraflagellar transport 80 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_028413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_028413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_028413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020800 Rosetta Predictions human pricing
NM_001013911 Rosetta Predictions rat pricing
NM_026641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024980 predicted 2006
2 SASI_Hs01_00024981 predicted 2371
3 SASI_Hs01_00024982 predicted 1775
4 SASI_Hs02_00353972 predicted 455
5 SASI_Hs02_00353973 predicted 2241
6 SASI_Hs02_00353974 predicted 1763
7 SASI_Hs01_00024983 predicted 2349
8 SASI_Hs01_00024985 predicted 1994
9 SASI_Hs01_00024987 predicted 1122
10 SASI_Hs01_00024988 predicted 2850
11 SASI_Hs01_00024979 predicted 1852
12 SASI_Hs01_00024984 predicted 513
13 SASI_Hs01_00024986 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201198 predicted 1220
2 SASI_Rn01_00109780 predicted 854
3 SASI_Rn01_00109781 predicted 642
4 SASI_Rn01_00109782 predicted 1368
5 SASI_Rn01_00109783 predicted 1237
6 SASI_Rn01_00109785 predicted 1307
7 SASI_Rn01_00109786 predicted 1055
8 SASI_Rn01_00109787 predicted 307
9 SASI_Rn01_00109788 predicted 883
10 SASI_Rn02_00201199 predicted 2197
11 SASI_Rn01_00109784 predicted 1531
12 SASI_Rn01_00109789 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182350 predicted 1165
2 SASI_Mm01_00182351 predicted 1464
3 SASI_Mm01_00182352 predicted 203
4 SASI_Mm02_00330632 predicted 238
5 SASI_Mm01_00182353 predicted 1315
6 SASI_Mm01_00182354 predicted 247
7 SASI_Mm02_00330633 predicted 1185
8 SASI_Mm01_00182355 predicted 1619
9 SASI_Mm01_00182356 predicted 998
10 SASI_Mm01_00182357 predicted 1647
11 SASI_Mm01_00182358 predicted 273
12 SASI_Mm01_00182359 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026641
IFT80 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 80 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-575s1c1
Sequence:CCGGGCAGGCAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-239s1c1
Sequence:CCGGCCTGATGACATCTACCCGATACTCGAGTATCGGGTAGATGTCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3510s1c1
Sequence:CCGGCCTCAGACTTAGAGTCTAAATCTCGAGATTTAGACTCTAAGTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3049s1c1
Sequence:CCGGCGGCAGTGATTAGTCTCTCATCTCGAGATGAGAGACTAATCACTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-357s1c1
Sequence:CCGGCCAAGTTAGGAAGAGTGGAAACTCGAGTTTCCACTCTTCCTAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-2224s1c1
Sequence:CCGGGCTCGCTTATCGTCAGAAGTTCTCGAGAACTTCTGACGATAAGCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1661s1c1
Sequence:CCGGCGATTCACAGTATGGTATTACCTCGAGGTAATACCATACTGTGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3649s1c1
Sequence:CCGGGCTCTTAGAATTGGTGCATTACTCGAGTAATGCACCAATTCTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1948s1c1
Sequence:CCGGGGCTGTTGCTAATCGAGATATCTCGAGATATCTCGATTAGCAACAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026641
IFT80 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 80 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-575s1c1
Sequence:CCGGGCAGGCAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-239s1c1
Sequence:CCGGCCTGATGACATCTACCCGATACTCGAGTATCGGGTAGATGTCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3510s1c1
Sequence:CCGGCCTCAGACTTAGAGTCTAAATCTCGAGATTTAGACTCTAAGTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3049s1c1
Sequence:CCGGCGGCAGTGATTAGTCTCTCATCTCGAGATGAGAGACTAATCACTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-357s1c1
Sequence:CCGGCCAAGTTAGGAAGAGTGGAAACTCGAGTTTCCACTCTTCCTAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-2224s1c1
Sequence:CCGGGCTCGCTTATCGTCAGAAGTTCTCGAGAACTTCTGACGATAAGCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1661s1c1
Sequence:CCGGCGATTCACAGTATGGTATTACCTCGAGGTAATACCATACTGTGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3649s1c1
Sequence:CCGGGCTCTTAGAATTGGTGCATTACTCGAGTAATGCACCAATTCTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1948s1c1
Sequence:CCGGGGCTGTTGCTAATCGAGATATCTCGAGATATCTCGATTAGCAACAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026641
IFT80 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 80 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-575s1c1
Sequence:CCGGGCAGGCAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-239s1c1
Sequence:CCGGCCTGATGACATCTACCCGATACTCGAGTATCGGGTAGATGTCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3510s1c1
Sequence:CCGGCCTCAGACTTAGAGTCTAAATCTCGAGATTTAGACTCTAAGTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3049s1c1
Sequence:CCGGCGGCAGTGATTAGTCTCTCATCTCGAGATGAGAGACTAATCACTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-357s1c1
Sequence:CCGGCCAAGTTAGGAAGAGTGGAAACTCGAGTTTCCACTCTTCCTAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-2224s1c1
Sequence:CCGGGCTCGCTTATCGTCAGAAGTTCTCGAGAACTTCTGACGATAAGCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1661s1c1
Sequence:CCGGCGATTCACAGTATGGTATTACCTCGAGGTAATACCATACTGTGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026641.1-3649s1c1
Sequence:CCGGGCTCTTAGAATTGGTGCATTACTCGAGTAATGCACCAATTCTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026641.1-1948s1c1
Sequence:CCGGGGCTGTTGCTAATCGAGATATCTCGAGATATCTCGATTAGCAACAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_028413
VALIDATED
IFT80 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 80 homolog (Chlamydomonas)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1636s1c1
Sequence:CCGGGCGCTTTATTTCATCTCCAAACTCGAGTTTGGAGATGAAATAAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-4150s1c1
Sequence:CCGGGCAGTGTACTTACAAGTTGTACTCGAGTACAACTTGTAAGTACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1049s1c1
Sequence:CCGGGCTGGTGAAGACTGTAAATATCTCGAGATATTTACAGTCTTCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-2243s1c1
Sequence:CCGGGCTGTGAGACTTTGTCGCTTTCTCGAGAAAGCGACAAAGTCTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-3247s1c1
Sequence:CCGGGCAGCATTACTGGAATAGCAACTCGAGTTGCTATTCCAGTAATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_028413.7-929s1c1
Sequence:CCGGGCAGGCAAGCAGCTAATCATTCTCGAGAATGATTAGCTGCTTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_028413
VALIDATED
IFT80 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 80 homolog (Chlamydomonas)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1636s1c1
Sequence:CCGGGCGCTTTATTTCATCTCCAAACTCGAGTTTGGAGATGAAATAAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-4150s1c1
Sequence:CCGGGCAGTGTACTTACAAGTTGTACTCGAGTACAACTTGTAAGTACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1049s1c1
Sequence:CCGGGCTGGTGAAGACTGTAAATATCTCGAGATATTTACAGTCTTCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-2243s1c1
Sequence:CCGGGCTGTGAGACTTTGTCGCTTTCTCGAGAAAGCGACAAAGTCTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-3247s1c1
Sequence:CCGGGCAGCATTACTGGAATAGCAACTCGAGTTGCTATTCCAGTAATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_028413.7-929s1c1
Sequence:CCGGGCAGGCAAGCAGCTAATCATTCTCGAGAATGATTAGCTGCTTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_028413
VALIDATED
IFT80 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 80 homolog (Chlamydomonas)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1636s1c1
Sequence:CCGGGCGCTTTATTTCATCTCCAAACTCGAGTTTGGAGATGAAATAAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134272    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-4150s1c1
Sequence:CCGGGCAGTGTACTTACAAGTTGTACTCGAGTACAACTTGTAAGTACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-1049s1c1
Sequence:CCGGGCTGGTGAAGACTGTAAATATCTCGAGATATTTACAGTCTTCACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-2243s1c1
Sequence:CCGGGCTGTGAGACTTTGTCGCTTTCTCGAGAAAGCGACAAAGTCTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_028413.7-3247s1c1
Sequence:CCGGGCAGCATTACTGGAATAGCAACTCGAGTTGCTATTCCAGTAATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_028413.7-929s1c1
Sequence:CCGGGCAGGCAAGCAGCTAATCATTCTCGAGAATGATTAGCTGCTTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)