EMAIL THIS PAGE TO A FRIEND

IFT81

intraflagellar transport 81 homolog (Chlamydomonas)

77 Gene Product Result for
Synonyms: CDV-1 CDV-1R CDV1 CDV1R
UniProtKB ID: Q8WYA0, Q2YDY1, Q8NB51, Q9BSV2, Q9UNY8
Gene ID:
Mouse(12589) intraflagellar transport 81
Rat(373066) intraflagellar transport 81 homolog (Chlamydomonas)
domestic guinea pig(100716600) intraflagellar transport 81 homolog (Chlamydomonas)
naked mole-rat(101721215) intraflagellar transport 81 homolog (Chlamydomonas)
sheep(101104093) intraflagellar transport 81 homolog (Chlamydomonas)
Zebrafish(432390) intraflagellar transport 81 homolog
chicken(416839) intraflagellar transport 81 homolog (Chlamydomonas)
domestic cat(101098168) intraflagellar transport 81 homolog (Chlamydomonas)
cow(519602) intraflagellar transport 81 homolog (Chlamydomonas)
dog(477472) intraflagellar transport 81 homolog (Chlamydomonas)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014055 Rosetta Predictions human pricing
NM_031473 Rosetta Predictions human pricing
NM_199120 Rosetta Predictions rat pricing
NM_009879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345068 predicted 1214
2 SASI_Hs01_00221772 predicted 826
3 SASI_Hs01_00221773 predicted 767
4 SASI_Hs01_00221775 predicted 1156
5 SASI_Hs01_00221776 predicted 778
6 SASI_Hs01_00221777 predicted 1012
7 SASI_Hs02_00345069 predicted 920
8 SASI_Hs01_00221778 predicted 534
9 SASI_Hs01_00221779 predicted 709
10 SASI_Hs01_00221780 predicted 841
11 SASI_Hs01_00221774 predicted 1158
12 SASI_Hs01_00221781 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358898 predicted 1088
2 SASI_Hs01_00189868 predicted 697
3 SASI_Hs01_00189869 predicted 640
4 SASI_Hs01_00189871 predicted 1040
5 SASI_Hs01_00189872 predicted 656
6 SASI_Hs01_00189873 predicted 894
7 SASI_Hs02_00358899 predicted 794
8 SASI_Hs01_00189874 predicted 410
9 SASI_Hs01_00189875 predicted 582
10 SASI_Hs01_00189876 predicted 726
11 SASI_Hs01_00189870 predicted 1036
12 SASI_Hs01_00189877 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046210 predicted 2217
2 SASI_Rn01_00046211 predicted 1274
3 SASI_Rn01_00046212 predicted 751
4 SASI_Rn02_00270147 predicted 1779
5 SASI_Rn01_00046213 predicted 1039
6 SASI_Rn01_00046214 predicted 875
7 SASI_Rn01_00046215 predicted 1103
8 SASI_Rn02_00270148 predicted 1846
9 SASI_Rn01_00046216 predicted 302
10 SASI_Rn01_00046217 predicted 692
11 SASI_Rn01_00046218 predicted 1672
12 SASI_Rn01_00046219 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123632 predicted 746
2 SASI_Mm02_00317353 predicted 299
3 SASI_Mm01_00123634 predicted 860
4 SASI_Mm02_00317354 predicted 603
5 SASI_Mm01_00123635 predicted 1275
6 SASI_Mm01_00123636 predicted 443
7 SASI_Mm01_00123637 predicted 2074
8 SASI_Mm01_00123638 predicted 1849
9 SASI_Mm01_00123639 predicted 286
10 SASI_Mm01_00123641 predicted 695
11 SASI_Mm01_00123633 predicted 1465
12 SASI_Mm01_00123640 predicted 2145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014055
IFT81 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 81 homolog (Chlamydomonas)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2971s21c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-593s21c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2821s21c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-1590s21c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-633s1c1
Sequence:CCGGGCTGAGATTGACCCAAAGCAACTCGAGTTGCTTTGGGTCAATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-1132s1c1
Sequence:CCGGCAAGGCAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014055.2-2957s1c1
Sequence:CCGGCGTTCAGCAGTTCCTACAGTTCTCGAGAACTGTAGGAACTGCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1056s1c1
Sequence:CCGGCAGCTCATTAAGAGAGTTGAACTCGAGTTCAACTCTCTTAATGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1548s1c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2929s1c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2779s1c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-551s1c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014055
IFT81 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 81 homolog (Chlamydomonas)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2971s21c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-593s21c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2821s21c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-1590s21c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-633s1c1
Sequence:CCGGGCTGAGATTGACCCAAAGCAACTCGAGTTGCTTTGGGTCAATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-1132s1c1
Sequence:CCGGCAAGGCAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014055.2-2957s1c1
Sequence:CCGGCGTTCAGCAGTTCCTACAGTTCTCGAGAACTGTAGGAACTGCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1056s1c1
Sequence:CCGGCAGCTCATTAAGAGAGTTGAACTCGAGTTCAACTCTCTTAATGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1548s1c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2929s1c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2779s1c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-551s1c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014055
IFT81 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 81 homolog (Chlamydomonas)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2971s21c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-593s21c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014055.3-2821s21c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014055.3-1590s21c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-633s1c1
Sequence:CCGGGCTGAGATTGACCCAAAGCAACTCGAGTTGCTTTGGGTCAATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014055.2-1132s1c1
Sequence:CCGGCAAGGCAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163327    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014055.2-2957s1c1
Sequence:CCGGCGTTCAGCAGTTCCTACAGTTCTCGAGAACTGTAGGAACTGCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1056s1c1
Sequence:CCGGCAGCTCATTAAGAGAGTTGAACTCGAGTTCAACTCTCTTAATGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-1548s1c1
Sequence:CCGGGCATCTATCATTTCCCGTAAACTCGAGTTTACGGGAAATGATAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2929s1c1
Sequence:CCGGCTCTTGTTCTGAAGAAACATTCTCGAGAATGTTTCTTCAGAACAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014055.2-2779s1c1
Sequence:CCGGGACAGGAAACTAAGTTTACTACTCGAGTAGTAAACTTAGTTTCCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014055.2-551s1c1
Sequence:CCGGGCCCTTTAGGAAGAACTATAACTCGAGTTATAGTTCTTCCTAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009879
VALIDATED
IFT81 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 81 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009879.3-2635s1c1
Sequence:CCGGGCCGTAGCTGTTGATCTTAAACTCGAGTTTAAGATCAACAGCTACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-1136s21c1
Sequence:CCGGGGCAACAGGCATCCATCATTTCTCGAGAAATGATGGATGCCTGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-412s21c1
Sequence:CCGGTGGCTTCTTCAGCGGAGTAATCTCGAGATTACTCCGCTGAAGAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-1291s21c1
Sequence:CCGGTTCAAGCGATACGTCAGTAAACTCGAGTTTACTGACGTATCGCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-186s21c1
Sequence:CCGGTTTGGGACCAATGCAACTATTCTCGAGAATAGTTGCATTGGTCCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-2158s21c1
Sequence:CCGGCGCATCTGCGTAACGTGATTTCTCGAGAAATCACGTTACGCAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-769s1c1
Sequence:CCGGGCACAACAGAAACAGGAACAACTCGAGTTGTTCCTGTTTCTGTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-1032s1c1
Sequence:CCGGCGAACTTGAGACTAAAGTCAACTCGAGTTGACTTTAGTCTCAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-293s1c1
Sequence:CCGGGAATGTTGAATCTTCTTGGTACTCGAGTACCAAGAAGATTCAACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009879
VALIDATED
IFT81 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 81 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009879.3-2635s1c1
Sequence:CCGGGCCGTAGCTGTTGATCTTAAACTCGAGTTTAAGATCAACAGCTACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-1136s21c1
Sequence:CCGGGGCAACAGGCATCCATCATTTCTCGAGAAATGATGGATGCCTGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-412s21c1
Sequence:CCGGTGGCTTCTTCAGCGGAGTAATCTCGAGATTACTCCGCTGAAGAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-1291s21c1
Sequence:CCGGTTCAAGCGATACGTCAGTAAACTCGAGTTTACTGACGTATCGCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-186s21c1
Sequence:CCGGTTTGGGACCAATGCAACTATTCTCGAGAATAGTTGCATTGGTCCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-2158s21c1
Sequence:CCGGCGCATCTGCGTAACGTGATTTCTCGAGAAATCACGTTACGCAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-769s1c1
Sequence:CCGGGCACAACAGAAACAGGAACAACTCGAGTTGTTCCTGTTTCTGTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-1032s1c1
Sequence:CCGGCGAACTTGAGACTAAAGTCAACTCGAGTTGACTTTAGTCTCAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-293s1c1
Sequence:CCGGGAATGTTGAATCTTCTTGGTACTCGAGTACCAAGAAGATTCAACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009879
VALIDATED
IFT81 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 81 homolog (Chlamydomonas)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009879.3-2635s1c1
Sequence:CCGGGCCGTAGCTGTTGATCTTAAACTCGAGTTTAAGATCAACAGCTACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-1136s21c1
Sequence:CCGGGGCAACAGGCATCCATCATTTCTCGAGAAATGATGGATGCCTGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-412s21c1
Sequence:CCGGTGGCTTCTTCAGCGGAGTAATCTCGAGATTACTCCGCTGAAGAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-1291s21c1
Sequence:CCGGTTCAAGCGATACGTCAGTAAACTCGAGTTTACTGACGTATCGCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009879.3-186s21c1
Sequence:CCGGTTTGGGACCAATGCAACTATTCTCGAGAATAGTTGCATTGGTCCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009879.3-2158s21c1
Sequence:CCGGCGCATCTGCGTAACGTGATTTCTCGAGAAATCACGTTACGCAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-769s1c1
Sequence:CCGGGCACAACAGAAACAGGAACAACTCGAGTTGTTCCTGTTTCTGTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-1032s1c1
Sequence:CCGGCGAACTTGAGACTAAAGTCAACTCGAGTTGACTTTAGTCTCAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009879.2-293s1c1
Sequence:CCGGGAATGTTGAATCTTCTTGGTACTCGAGTACCAAGAAGATTCAACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)