EMAIL THIS PAGE TO A FRIEND

IGBP1

immunoglobulin (CD79A) binding protein 1

88 Gene Product Result for
Synonyms: ALPHA-4 IBP1
UniProtKB ID: P78318, Q8TAB2
Gene ID:
Human(3476) Summary: The proliferation and differentiation of B cells is dependent upon a B-cell antigen receptor (BCR) complex. Binding of antigens to specific B-cell receptors results in a tyrosine phosphorylation reaction through the BCR complex and leads to multiple signal transduction pathways. [provided by RefSeq, Jul 2008]
Mouse(18518) immunoglobulin (CD79A) binding protein 1
Rat(58845) immunoglobulin (CD79A) binding protein 1
Zebrafish(406843) immunoglobulin (CD79A) binding protein 1
chicken(768951) immunoglobulin (CD79A) binding protein 1
cow(100296883) immunoglobulin (CD79A) binding protein 1
domestic cat(101087383) immunoglobulin (CD79A) binding protein 1
dog(480950) immunoglobulin (CD79A) binding protein 1
sheep(101121748) immunoglobulin (CD79A) binding protein 1
domestic guinea pig(100733701) immunoglobulin (CD79A) binding protein 1
naked mole-rat(101703385) immunoglobulin (CD79A) binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_196586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_196586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_196586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_008784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001551 Rosetta Predictions human pricing
NM_031624 Rosetta Predictions rat pricing
NM_008784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083851 predicted 349
2 SASI_Hs01_00083852 predicted 358
3 SASI_Hs01_00083853 predicted 896
4 SASI_Hs01_00083854 predicted 644
5 SASI_Hs01_00083855 predicted 741
6 SASI_Hs01_00083856 predicted 877
7 SASI_Hs01_00083858 predicted 901
8 SASI_Hs01_00083859 predicted 1105
9 SASI_Hs02_00332108 predicted 704
10 SASI_Hs02_00332109 predicted 621
11 SASI_Hs01_00083850 predicted 805
12 SASI_Hs01_00083857 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061633 predicted 646
2 SASI_Rn01_00061634 predicted 1024
3 SASI_Rn01_00061635 predicted 367
4 SASI_Rn01_00061636 predicted 827
5 SASI_Rn01_00061637 predicted 692
6 SASI_Rn01_00061638 predicted 326
7 SASI_Rn01_00061639 predicted 459
8 SASI_Rn01_00061640 predicted 718
9 SASI_Rn01_00061641 predicted 198
10 SASI_Rn01_00061642 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052952 predicted 650
2 SASI_Mm01_00052953 predicted 374
3 SASI_Mm01_00052954 predicted 477
4 SASI_Mm01_00052955 predicted 460
5 SASI_Mm01_00052957 predicted 1029
6 SASI_Mm02_00314683 predicted 621
7 SASI_Mm01_00052959 predicted 697
8 SASI_Mm01_00052960 predicted 959
9 SASI_Mm01_00052961 predicted 744
10 SASI_Mm02_00314684 predicted 205
11 SASI_Mm01_00052956 predicted 623
12 SASI_Mm01_00052958 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001551
VALIDATED
IGBP1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin (CD79A) binding protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-67s1c1
Sequence:CCGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-796s1c1
Sequence:CCGGCAACTATGACGGTGAGTGACTCTCGAGAGTCACTCACCGTCATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-1110s1c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-462s1c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-183s1c1
Sequence:CCGGCTCGACTTGTTCAGCCGAAATCTCGAGATTTCGGCTGAACAAGTCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001551.2-1010s21c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-1170s1c1
Sequence:CCGGGTCAAGTGATTAAGTGTGTATCTCGAGATACACACTTAATCACTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-897s1c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-720s1c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-357s21c1
Sequence:CCGGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-1187s21c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-752s21c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001551.2-1401s21c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001551
VALIDATED
IGBP1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin (CD79A) binding protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-67s1c1
Sequence:CCGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-796s1c1
Sequence:CCGGCAACTATGACGGTGAGTGACTCTCGAGAGTCACTCACCGTCATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-1110s1c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-462s1c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-183s1c1
Sequence:CCGGCTCGACTTGTTCAGCCGAAATCTCGAGATTTCGGCTGAACAAGTCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001551.2-1010s21c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-1170s1c1
Sequence:CCGGGTCAAGTGATTAAGTGTGTATCTCGAGATACACACTTAATCACTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-897s1c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-720s1c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-357s21c1
Sequence:CCGGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-1187s21c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-752s21c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001551.2-1401s21c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001551
VALIDATED
IGBP1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin (CD79A) binding protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-67s1c1
Sequence:CCGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-796s1c1
Sequence:CCGGCAACTATGACGGTGAGTGACTCTCGAGAGTCACTCACCGTCATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.x-1110s1c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-462s1c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-183s1c1
Sequence:CCGGCTCGACTTGTTCAGCCGAAATCTCGAGATTTCGGCTGAACAAGTCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001551.2-1010s21c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-1170s1c1
Sequence:CCGGGTCAAGTGATTAAGTGTGTATCTCGAGATACACACTTAATCACTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-897s1c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001551.1-720s1c1
Sequence:CCGGCCTCCAGTGAAACCCTTCATTCTCGAGAATGAAGGGTTTCACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-357s21c1
Sequence:CCGGGACAGTTACTGGACGAAGTAGCTCGAGCTACTTCGTCCAGTAACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-1187s21c1
Sequence:CCGGGCTCAGCAACAGGAAGAACAACTCGAGTTGTTCTTCCTGTTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001551.2-752s21c1
Sequence:CCGGGCATCTCAAAGACAGGCTAAACTCGAGTTTAGCCTGTCTTTGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001551.2-1401s21c1
Sequence:CCGGTGCTTCAGCTCTGTACAACGACTCGAGTCGTTGTACAGAGCTGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_196586
IGBP1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin (CD79A) binding protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-758s1c1
Sequence:CCGGCCAAAGTATTTGGAACTGGTTCTCGAGAACCAGTTCCAAATACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-714s1c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-639s1c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-160s1c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-177s1c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_196586
IGBP1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin (CD79A) binding protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-758s1c1
Sequence:CCGGCCAAAGTATTTGGAACTGGTTCTCGAGAACCAGTTCCAAATACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-714s1c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-639s1c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-160s1c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-177s1c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_196586
IGBP1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin (CD79A) binding protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-758s1c1
Sequence:CCGGCCAAAGTATTTGGAACTGGTTCTCGAGAACCAGTTCCAAATACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-714s1c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-639s1c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-160s1c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_196586.3-177s1c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008784
IGBP1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin (CD79A) binding protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000325761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-660s21c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-735s21c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-198s21c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-181s21c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008784
IGBP1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin (CD79A) binding protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000325761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-660s21c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-735s21c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-198s21c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-181s21c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008784
IGBP1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin (CD79A) binding protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000325761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-660s21c1
Sequence:CCGGCCAGGAAATAAAGATCCTGAACTCGAGTTCAGGATCTTTATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-735s21c1
Sequence:CCGGGCCTCCAATGAAACCCTTCATCTCGAGATGAAGGGTTTCATTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-198s21c1
Sequence:CCGGGCTTGATTTGTTCAGCCGAAACTCGAGTTTCGGCTGAACAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008784.2-181s21c1
Sequence:CCGGGCTGGAATGTTATCGCAGCTTCTCGAGAAGCTGCGATAACATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)