EMAIL THIS PAGE TO A FRIEND

IGBP1P2

immunoglobulin (CD79A) binding protein 1 pseudogene 2

20 Gene Product Result for
Species: Human IGBP1P2(645545)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101392 Rosetta Predictions human pricing
XM_928563 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322782 predicted 705
2 SASI_Hs02_00322783 predicted 830
3 SASI_Hs02_00322784 predicted 365
4 SASI_Hs02_00322785 predicted 390
5 SASI_Hs02_00322786 predicted 1024
6 SASI_Hs02_00322787 predicted 818
7 SASI_Hs02_00322788 predicted 380
8 SASI_Hs02_00322789 predicted 1011
9 SASI_Hs02_00322790 predicted 363
10 SASI_Hs02_00322791 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292406 predicted 389
2 SASI_Hs01_00292407 predicted 517
3 SASI_Hs01_00292408 predicted 710
4 SASI_Hs01_00292409 predicted 507
5 SASI_Hs01_00292410 predicted 691
6 SASI_Hs01_00292411 predicted 792
7 SASI_Hs01_00292412 predicted 209
8 SASI_Hs01_00292413 predicted 815
9 SASI_Hs01_00292414 predicted 60
10 SASI_Hs01_00292415 predicted 65
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101392
IGBP1P2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin (CD79A) binding protein 1 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-1138s21c1
Sequence:CCGGGGTATGATCAACATCAGAAACCTCGAGGTTTCTGATGTTGATCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-564s21c1
Sequence:CCGGCTGATGGTGCCAGCGTTTCAACTCGAGTTGAAACGCTGGCACCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-682s21c1
Sequence:CCGGACTATCGTGTGGCCGAGTTTGCTCGAGCAAACTCGGCCACACGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-524s21c1
Sequence:CCGGTGAAGATTTGGAGGAGATTACCTCGAGGTAATCTCCTCCAAATCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-745s21c1
Sequence:CCGGCTATTACCTCCACGGCTTATCCTCGAGGATAAGCCGTGGAGGTAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101392
IGBP1P2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin (CD79A) binding protein 1 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-1138s21c1
Sequence:CCGGGGTATGATCAACATCAGAAACCTCGAGGTTTCTGATGTTGATCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-564s21c1
Sequence:CCGGCTGATGGTGCCAGCGTTTCAACTCGAGTTGAAACGCTGGCACCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-682s21c1
Sequence:CCGGACTATCGTGTGGCCGAGTTTGCTCGAGCAAACTCGGCCACACGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-524s21c1
Sequence:CCGGTGAAGATTTGGAGGAGATTACCTCGAGGTAATCTCCTCCAAATCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-745s21c1
Sequence:CCGGCTATTACCTCCACGGCTTATCCTCGAGGATAAGCCGTGGAGGTAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101392
IGBP1P2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin (CD79A) binding protein 1 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-1138s21c1
Sequence:CCGGGGTATGATCAACATCAGAAACCTCGAGGTTTCTGATGTTGATCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-564s21c1
Sequence:CCGGCTGATGGTGCCAGCGTTTCAACTCGAGTTGAAACGCTGGCACCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-682s21c1
Sequence:CCGGACTATCGTGTGGCCGAGTTTGCTCGAGCAAACTCGGCCACACGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-524s21c1
Sequence:CCGGTGAAGATTTGGAGGAGATTACCTCGAGGTAATCTCCTCCAAATCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101392.1-745s21c1
Sequence:CCGGCTATTACCTCCACGGCTTATCCTCGAGGATAAGCCGTGGAGGTAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)