EMAIL THIS PAGE TO A FRIEND

IGDCC3

immunoglobulin superfamily, DCC subclass, member 3

69 Gene Product Result for
Synonyms: HsT18880 PUNC
UniProtKB ID: Q8IVU1, O95215
Gene ID:
Mouse(19289) immunoglobulin superfamily, DCC subclass, member 3
Rat(315759) immunoglobulin superfamily, DCC subclass, member 3
Zebrafish(555947) immunoglobulin superfamily, DCC subclass, member 3
cow(529830) immunoglobulin superfamily, DCC subclass, member 3
cow(100140359) immunoglobulin superfamily, DCC subclass, member 3
Horse(100066368) immunoglobulin superfamily, DCC subclass, member 3
domestic cat(101095745) immunoglobulin superfamily, DCC subclass, member 3
dog(478344) immunoglobulin superfamily, DCC subclass, member 3
chicken(415535) immunoglobulin superfamily, DCC subclass, member 3
domestic guinea pig(100721303) immunoglobulin superfamily, DCC subclass, member 3
naked mole-rat(101712647) immunoglobulin superfamily, DCC subclass, member 3
sheep(101111458) immunoglobulin superfamily, DCC subclass, member 3
Domestic Rabbit(100350346) immunoglobulin superfamily, DCC subclass, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004884 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004884 Rosetta Predictions human pricing
NM_001108160 Rosetta Predictions rat pricing
NM_008988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112155 predicted 1013
2 SASI_Hs01_00112156 predicted 1397
3 SASI_Hs01_00112157 predicted 1602
4 SASI_Hs01_00112158 predicted 1161
5 SASI_Hs02_00338515 predicted 1418
6 SASI_Hs01_00112159 predicted 2165
7 SASI_Hs02_00338516 predicted 841
8 SASI_Hs01_00112161 predicted 2373
9 SASI_Hs01_00112162 predicted 603
10 SASI_Hs02_00338517 predicted 1925
11 SASI_Hs01_00112154 predicted 1326
12 SASI_Hs01_00112160 predicted 1399
13 SASI_Hs01_00112163 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235944 predicted 247
2 SASI_Rn02_00235945 predicted 219
3 SASI_Rn02_00235946 predicted 210
4 SASI_Rn02_00235947 predicted 211
5 SASI_Rn02_00235948 predicted 223
6 SASI_Rn02_00235949 predicted 264
7 SASI_Rn02_00235950 predicted 278
8 SASI_Rn02_00235951 predicted 234
9 SASI_Rn02_00235952 predicted 211
10 SASI_Rn02_00235953 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097015 predicted 1618
2 SASI_Mm01_00097016 predicted 610
3 SASI_Mm01_00097018 predicted 1448
4 SASI_Mm01_00097019 predicted 2112
5 SASI_Mm01_00097020 predicted 1738
6 SASI_Mm02_00315083 predicted 1121
7 SASI_Mm01_00097021 predicted 773
8 SASI_Mm02_00315084 predicted 1332
9 SASI_Mm01_00097022 predicted 2048
10 SASI_Mm02_00315085 predicted 957
11 SASI_Mm01_00097017 predicted 1138
12 SASI_Mm01_00097023 predicted 967
13 SASI_Mm01_00097024 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008988
IGDCC3 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, DCC subclass, member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008988.2-2694s21c1
Sequence:CCGGTGAAGGACAGGGTTCTCAAACCTCGAGGTTTGAGAACCCTGTCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1906s1c1
Sequence:CCGGCCAACACAATGGAGGCTTCAACTCGAGTTGAAGCCTCCATTGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1607s1c1
Sequence:CCGGGCCCACACCAAAGAGATCATTCTCGAGAATGATCTCTTTGGTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-587s1c1
Sequence:CCGGCCTTCAGATGAGGGTGACTATCTCGAGATAGTCACCCTCATCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008988.2-374s21c1
Sequence:CCGGCATTCTGCTGAACTGGCATTTCTCGAGAAATGCCAGTTCAGCAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-398s1c1
Sequence:CCGGGTGGAGCCAAATGATGATATTCTCGAGAATATCATCATTTGGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008988.1-2789s1c1
Sequence:CCGGCCATAGGACTTAGGAAACAAACTCGAGTTTGTTTCCTAAGTCCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008988
IGDCC3 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, DCC subclass, member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008988.2-2694s21c1
Sequence:CCGGTGAAGGACAGGGTTCTCAAACCTCGAGGTTTGAGAACCCTGTCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1906s1c1
Sequence:CCGGCCAACACAATGGAGGCTTCAACTCGAGTTGAAGCCTCCATTGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1607s1c1
Sequence:CCGGGCCCACACCAAAGAGATCATTCTCGAGAATGATCTCTTTGGTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-587s1c1
Sequence:CCGGCCTTCAGATGAGGGTGACTATCTCGAGATAGTCACCCTCATCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008988.2-374s21c1
Sequence:CCGGCATTCTGCTGAACTGGCATTTCTCGAGAAATGCCAGTTCAGCAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-398s1c1
Sequence:CCGGGTGGAGCCAAATGATGATATTCTCGAGAATATCATCATTTGGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008988.1-2789s1c1
Sequence:CCGGCCATAGGACTTAGGAAACAAACTCGAGTTTGTTTCCTAAGTCCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008988
IGDCC3 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, DCC subclass, member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008988.2-2694s21c1
Sequence:CCGGTGAAGGACAGGGTTCTCAAACCTCGAGGTTTGAGAACCCTGTCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1906s1c1
Sequence:CCGGCCAACACAATGGAGGCTTCAACTCGAGTTGAAGCCTCCATTGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-1607s1c1
Sequence:CCGGGCCCACACCAAAGAGATCATTCTCGAGAATGATCTCTTTGGTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-587s1c1
Sequence:CCGGCCTTCAGATGAGGGTGACTATCTCGAGATAGTCACCCTCATCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008988.2-374s21c1
Sequence:CCGGCATTCTGCTGAACTGGCATTTCTCGAGAAATGCCAGTTCAGCAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008988.1-398s1c1
Sequence:CCGGGTGGAGCCAAATGATGATATTCTCGAGAATATCATCATTTGGCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008988.1-2789s1c1
Sequence:CCGGCCATAGGACTTAGGAAACAAACTCGAGTTTGTTTCCTAAGTCCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004884
IGDCC3 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, DCC subclass, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-2320s1c1
Sequence:CCGGGAGACGAGAAACGTGTGGATACTCGAGTATCCACACGTTTCTCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-336s1c1
Sequence:CCGGGTGGAGCCAAGTGATGATGTTCTCGAGAACATCATCACTTGGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-717s1c1
Sequence:CCGGGAGAAGAACAGAGTCCCAATTCTCGAGAATTGGGACTCTGTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-681s1c1
Sequence:CCGGCAAATCCATGGGCTTCCCAAACTCGAGTTTGGGAAGCCCATGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-1374s1c1
Sequence:CCGGCCTGAGGATGAAGCCATTTATCTCGAGATAAATGGCTTCATCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004884
IGDCC3 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, DCC subclass, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-2320s1c1
Sequence:CCGGGAGACGAGAAACGTGTGGATACTCGAGTATCCACACGTTTCTCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-336s1c1
Sequence:CCGGGTGGAGCCAAGTGATGATGTTCTCGAGAACATCATCACTTGGCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-717s1c1
Sequence:CCGGGAGAAGAACAGAGTCCCAATTCTCGAGAATTGGGACTCTGTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-681s1c1
Sequence:CCGGCAAATCCATGGGCTTCCCAAACTCGAGTTTGGGAAGCCCATGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-1374s1c1
Sequence:CCGGCCTGAGGATGAAGCCATTTATCTCGAGATAAATGGCTTCATCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004884
IGDCC3 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, DCC subclass, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-2320s1c1
Sequence:CCGGGAGACGAGAAACGTGTGGATACTCGAGTATCCACACGTTTCTCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-336s1c1
Sequence:CCGGGTGGAGCCAAGTGATGATGTTCTCGAGAACATCATCACTTGGCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-717s1c1
Sequence:CCGGGAGAAGAACAGAGTCCCAATTCTCGAGAATTGGGACTCTGTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-681s1c1
Sequence:CCGGCAAATCCATGGGCTTCCCAAACTCGAGTTTGGGAAGCCCATGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004884.1-1374s1c1
Sequence:CCGGCCTGAGGATGAAGCCATTTATCTCGAGATAAATGGCTTCATCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)