EMAIL THIS PAGE TO A FRIEND

IGDCC4

immunoglobulin superfamily, DCC subclass, member 4

145 Gene Product Result for
Synonyms: DDM36 NOPE
UniProtKB ID: Q8TDY8, Q9HCE4
Gene ID:
Mouse(56741) immunoglobulin superfamily, DCC subclass, member 4
Rat(363081) immunoglobulin superfamily, DCC subclass, member 4
sheep(101111715) immunoglobulin superfamily, DCC subclass, member 4
Domestic Rabbit(100349855) immunoglobulin superfamily, DCC subclass, member 4
domestic guinea pig(100721033) immunoglobulin superfamily, DCC subclass, member 4
naked mole-rat(101721989) immunoglobulin superfamily, DCC subclass, member 4
Zebrafish(100141327) immunoglobulin superfamily, DCC subclass, member 4
chicken(415537) immunoglobulin superfamily, DCC subclass, member 4
cow(541098) immunoglobulin superfamily, DCC subclass, member 4
Horse(100066342) immunoglobulin superfamily, DCC subclass, member 4
domestic cat(101095499) immunoglobulin superfamily, DCC subclass, member 4
dog(487604) immunoglobulin superfamily, DCC subclass, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020962 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020962 Rosetta Predictions human pricing
NM_001108767 Rosetta Predictions rat pricing
NM_020043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141071 predicted 549
2 SASI_Hs01_00141072 predicted 689
3 SASI_Hs01_00141074 predicted 3880
4 SASI_Hs01_00141075 predicted 1132
5 SASI_Hs01_00141076 predicted 3543
6 SASI_Hs01_00141077 predicted 1948
7 SASI_Hs01_00141078 predicted 3789
8 SASI_Hs01_00141079 predicted 1985
9 SASI_Hs01_00141080 predicted 2000
10 SASI_Hs02_00354392 predicted 3995
11 SASI_Hs01_00141073 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241875 predicted 3332
2 SASI_Rn02_00241876 predicted 2678
3 SASI_Rn02_00241877 predicted 3362
4 SASI_Rn02_00241878 predicted 3066
5 SASI_Rn02_00241879 predicted 3366
6 SASI_Rn02_00241880 predicted 3738
7 SASI_Rn02_00241881 predicted 1855
8 SASI_Rn02_00241882 predicted 3088
9 SASI_Rn02_00241883 predicted 3083
10 SASI_Rn02_00241884 predicted 2656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189956 predicted 2665
2 SASI_Mm02_00325409 predicted 957
3 SASI_Mm01_00189957 predicted 3163
4 SASI_Mm01_00189958 predicted 2353
5 SASI_Mm01_00189959 predicted 1388
6 SASI_Mm01_00189960 predicted 1522
7 SASI_Mm01_00189961 predicted 1768
8 SASI_Mm01_00189962 predicted 2481
9 SASI_Mm01_00189963 predicted 3434
10 SASI_Mm01_00189964 predicted 3014
11 SASI_Mm01_00189965 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020043
VALIDATED
IGDCC4 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, DCC subclass, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020043.1-3884s1c1
Sequence:CCGGCCTCATATTCTGCATCACATACTCGAGTATGTGATGCAGAATATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1735s1c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-3321s1c1
Sequence:CCGGCCTGGTGTATGACGGCATAAACTCGAGTTTATGCCGTCATACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1364s1c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-2440s1c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1515s21c1
Sequence:CCGGTGGAACCCAACACGGATTATGCTCGAGCATAATCCGTGTTGGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020043.2-3849s21c1
Sequence:CCGGGTGTACTAGAGATATCCATAACTCGAGTTATGGATATCTCTAGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020043.2-2480s21c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1404s21c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1775s21c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020043
VALIDATED
IGDCC4 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, DCC subclass, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020043.1-3884s1c1
Sequence:CCGGCCTCATATTCTGCATCACATACTCGAGTATGTGATGCAGAATATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1735s1c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-3321s1c1
Sequence:CCGGCCTGGTGTATGACGGCATAAACTCGAGTTTATGCCGTCATACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1364s1c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-2440s1c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1515s21c1
Sequence:CCGGTGGAACCCAACACGGATTATGCTCGAGCATAATCCGTGTTGGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020043.2-3849s21c1
Sequence:CCGGGTGTACTAGAGATATCCATAACTCGAGTTATGGATATCTCTAGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020043.2-2480s21c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1404s21c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1775s21c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020043
VALIDATED
IGDCC4 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, DCC subclass, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020043.1-3884s1c1
Sequence:CCGGCCTCATATTCTGCATCACATACTCGAGTATGTGATGCAGAATATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1735s1c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-3321s1c1
Sequence:CCGGCCTGGTGTATGACGGCATAAACTCGAGTTTATGCCGTCATACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020043.1-1364s1c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020043.1-2440s1c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1515s21c1
Sequence:CCGGTGGAACCCAACACGGATTATGCTCGAGCATAATCCGTGTTGGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020043.2-3849s21c1
Sequence:CCGGGTGTACTAGAGATATCCATAACTCGAGTTATGGATATCTCTAGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020043.2-2480s21c1
Sequence:CCGGCCATTTACCAAGTACGAGTTTCTCGAGAAACTCGTACTTGGTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1404s21c1
Sequence:CCGGGCGAGCAAATCATTGGCTTCTCTCGAGAGAAGCCAATGATTTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020043.2-1775s21c1
Sequence:CCGGCCTGGAAATGAGACACAACTTCTCGAGAAGTTGTGTCTCATTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020962
IGDCC4 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, DCC subclass, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020962.1-5897s1c1
Sequence:CCGGCCCTGAATTAAATGGCTGTTTCTCGAGAAACAGCCATTTAATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2652s1c1
Sequence:CCGGGCCATTCACCAAATACGAGTTCTCGAGAACTCGTATTTGGTGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-1980s1c1
Sequence:CCGGGCTTCAGCCAAACAAGGTGTACTCGAGTACACCTTGTTTGGCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2653s1c1
Sequence:CCGGCCATTCACCAAATACGAGTTTCTCGAGAAACTCGTATTTGGTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2365s1c1
Sequence:CCGGGCTTTCAACAAACATGAGGATCTCGAGATCCTCATGTTTGTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-3619s21c1
Sequence:CCGGTCTGACTTTAGTGCATCTAACCTCGAGGTTAGATGCACTAAAGTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-548s21c1
Sequence:CCGGGGGTCATTGAAGGCAACTATTCTCGAGAATAGTTGCCTTCAATGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-1936s21c1
Sequence:CCGGTCTACTGAGGTGCGAGGAAATCTCGAGATTTCCTCGCACCTCAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020962
IGDCC4 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, DCC subclass, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020962.1-5897s1c1
Sequence:CCGGCCCTGAATTAAATGGCTGTTTCTCGAGAAACAGCCATTTAATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2652s1c1
Sequence:CCGGGCCATTCACCAAATACGAGTTCTCGAGAACTCGTATTTGGTGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-1980s1c1
Sequence:CCGGGCTTCAGCCAAACAAGGTGTACTCGAGTACACCTTGTTTGGCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2653s1c1
Sequence:CCGGCCATTCACCAAATACGAGTTTCTCGAGAAACTCGTATTTGGTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2365s1c1
Sequence:CCGGGCTTTCAACAAACATGAGGATCTCGAGATCCTCATGTTTGTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-3619s21c1
Sequence:CCGGTCTGACTTTAGTGCATCTAACCTCGAGGTTAGATGCACTAAAGTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-548s21c1
Sequence:CCGGGGGTCATTGAAGGCAACTATTCTCGAGAATAGTTGCCTTCAATGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-1936s21c1
Sequence:CCGGTCTACTGAGGTGCGAGGAAATCTCGAGATTTCCTCGCACCTCAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020962
IGDCC4 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, DCC subclass, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020962.1-5897s1c1
Sequence:CCGGCCCTGAATTAAATGGCTGTTTCTCGAGAAACAGCCATTTAATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2652s1c1
Sequence:CCGGGCCATTCACCAAATACGAGTTCTCGAGAACTCGTATTTGGTGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-1980s1c1
Sequence:CCGGGCTTCAGCCAAACAAGGTGTACTCGAGTACACCTTGTTTGGCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2653s1c1
Sequence:CCGGCCATTCACCAAATACGAGTTTCTCGAGAAACTCGTATTTGGTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020962.1-2365s1c1
Sequence:CCGGGCTTTCAACAAACATGAGGATCTCGAGATCCTCATGTTTGTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-3619s21c1
Sequence:CCGGTCTGACTTTAGTGCATCTAACCTCGAGGTTAGATGCACTAAAGTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-548s21c1
Sequence:CCGGGGGTCATTGAAGGCAACTATTCTCGAGAATAGTTGCCTTCAATGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020962.1-1936s21c1
Sequence:CCGGTCTACTGAGGTGCGAGGAAATCTCGAGATTTCCTCGCACCTCAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)