EMAIL THIS PAGE TO A FRIEND

IGF1

insulin-like growth factor 1 (somatomedin C)

414 Gene Product Result for
Synonyms: IGF-I IGF1A IGFI
UniProtKB ID: P05019, B2RWM7, E9PD02, P01343, Q14620
Gene ID:
Human(3479) Summary: The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Mouse(16000) insulin-like growth factor 1
Rat(24482) insulin-like growth factor 1
sheep(443318) insulin-like growth factor 1 (somatomedin C)
Domestic Rabbit(100008668) insulin-like growth factor 1 (somatomedin C)
domestic guinea pig(100135551) insulin-like growth factor 1
Zebrafish(114433) insulin-like growth factor 1
domestic cat(101101237) insulin-like growth factor 1 (somatomedin C)
Horse(100034198) insulin-like growth factor 1 (somatomedin C)
cow(281239) insulin-like growth factor 1 (somatomedin C)
dog(610255) insulin-like growth factor 1 (somatomedin C)
chicken(418090) insulin-like growth factor 1 (somatomedin C)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T7697 I-OMe-Tyrphostin AG 538 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000618 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059801 MISSION® esiRNA esiRNA human IGF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000618 Rosetta Predictions human pricing
NM_001111283 Rosetta Predictions human pricing
NM_001111284 Rosetta Predictions human pricing
NM_001111285 Rosetta Predictions human pricing
NM_001082477 Rosetta Predictions rat pricing
NM_001082478 Rosetta Predictions rat pricing
NM_001082479 Rosetta Predictions rat pricing
NM_178866 Rosetta Predictions rat pricing
NM_001111274 Rosetta Predictions mouse pricing
NM_001111275 Rosetta Predictions mouse pricing
NM_001111276 Rosetta Predictions mouse pricing
NM_010512 Rosetta Predictions mouse pricing
NM_184052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302944 predicted 1006
2 SASI_Hs02_00302945 predicted 231
3 SASI_Hs02_00302946 predicted 1140
4 SASI_Hs02_00302947 predicted 826
5 SASI_Hs02_00302948 predicted 748
6 SASI_Hs02_00302949 predicted 991
7 SASI_Hs02_00302950 predicted 982
8 SASI_Hs02_00302951 predicted 715
9 SASI_Hs01_00073589 predicted 617
10 SASI_Hs02_00302952 predicted 745
11 SASI_Hs01_00073582 predicted 1127
12 SASI_Hs01_00073583 predicted 541
13 SASI_Hs01_00073584 predicted 427
14 SASI_Hs01_00073585 predicted 1122
15 SASI_Hs01_00073586 predicted 1121
16 SASI_Hs01_00073587 predicted 332
17 SASI_Hs01_00073588 predicted 277
18 SASI_Hs01_00073590 predicted 654
19 SASI_Hs01_00073591 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325304 predicted 1064
2 SASI_Hs02_00325305 predicted 1188
3 SASI_Hs02_00325306 predicted 874
4 SASI_Hs02_00325307 predicted 799
5 SASI_Hs02_00325308 predicted 1045
6 SASI_Hs02_00325309 predicted 663
7 SASI_Hs02_00325310 predicted 1025
8 SASI_Hs02_00325311 predicted 769
9 SASI_Hs02_00325312 predicted 791
10 SASI_Hs02_00325313 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325314 predicted 893
2 SASI_Hs02_00325315 predicted 1020
3 SASI_Hs02_00325316 predicted 154
4 SASI_Hs02_00325317 predicted 704
5 SASI_Hs02_00325318 predicted 636
6 SASI_Hs02_00325319 predicted 878
7 SASI_Hs02_00325320 predicted 866
8 SASI_Hs02_00325321 predicted 604
9 SASI_Hs02_00325322 predicted 501
10 SASI_Hs02_00325323 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325324 predicted 229
2 SASI_Hs02_00325325 predicted 327
3 SASI_Hs02_00325326 predicted 298
4 SASI_Hs02_00325327 predicted 233
5 SASI_Hs02_00325328 predicted 321
6 SASI_Hs02_00325329 predicted 389
7 SASI_Hs02_00325330 predicted 378
8 SASI_Hs02_00325331 predicted 324
9 SASI_Hs02_00325332 predicted 381
10 SASI_Hs02_00325333 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208719 predicted 360
2 SASI_Rn02_00208720 predicted 861
3 SASI_Rn02_00208721 predicted 929
4 SASI_Rn02_00208722 predicted 575
5 SASI_Rn02_00208723 predicted 532
6 SASI_Rn02_00208724 predicted 880
7 SASI_Rn02_00208725 predicted 630
8 SASI_Rn02_00208726 predicted 759
9 SASI_Rn02_00208727 predicted 645
10 SASI_Rn02_00208728 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208729 predicted 655
2 SASI_Rn02_00208730 predicted 352
3 SASI_Rn02_00208731 predicted 284
4 SASI_Rn02_00208732 predicted 383
5 SASI_Rn02_00208733 predicted 531
6 SASI_Rn02_00208734 predicted 287
7 SASI_Rn02_00208735 predicted 625
8 SASI_Rn02_00208736 predicted 544
9 SASI_Rn02_00208737 predicted 296
10 SASI_Rn02_00208738 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208739 predicted 1105
2 SASI_Rn02_00208740 predicted 1176
3 SASI_Rn02_00208741 predicted 824
4 SASI_Rn02_00208742 predicted 771
5 SASI_Rn02_00208743 predicted 1127
6 SASI_Rn02_00208744 predicted 873
7 SASI_Rn02_00208745 predicted 659
8 SASI_Rn02_00208746 predicted 1001
9 SASI_Rn02_00208747 predicted 1126
10 SASI_Rn02_00208748 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269650 predicted 806
2 SASI_Rn02_00269651 predicted 882
3 SASI_Rn02_00269652 predicted 531
4 SASI_Rn02_00269653 predicted 479
5 SASI_Rn02_00269654 predicted 833
6 SASI_Rn02_00269655 predicted 578
7 SASI_Rn02_00269656 predicted 358
8 SASI_Rn02_00269657 predicted 702
9 SASI_Rn02_00269658 predicted 827
10 SASI_Rn01_00066542 predicted 368
11 SASI_Rn01_00066538 predicted 821
12 SASI_Rn01_00066539 predicted 952
13 SASI_Rn01_00066540 predicted 979
14 SASI_Rn01_00066541 predicted 978
15 SASI_Rn01_00066543 predicted 1129
16 SASI_Rn01_00066544 predicted 985
17 SASI_Rn01_00066545 predicted 1105
18 SASI_Rn01_00066546 predicted 957
19 SASI_Rn01_00066547 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306602 predicted 1077
2 SASI_Mm02_00306603 predicted 1129
3 SASI_Mm02_00306604 predicted 794
4 SASI_Mm02_00306605 predicted 1119
5 SASI_Mm02_00306606 predicted 795
6 SASI_Mm02_00306607 predicted 1102
7 SASI_Mm02_00306608 predicted 269
8 SASI_Mm02_00306609 predicted 867
9 SASI_Mm02_00306610 predicted 829
10 SASI_Mm02_00306611 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306612 predicted 1107
2 SASI_Mm02_00306613 predicted 1167
3 SASI_Mm02_00306614 predicted 818
4 SASI_Mm02_00306615 predicted 1151
5 SASI_Mm02_00306616 predicted 824
6 SASI_Mm02_00306617 predicted 1134
7 SASI_Mm02_00306618 predicted 900
8 SASI_Mm02_00306619 predicted 854
9 SASI_Mm02_00306620 predicted 583
10 SASI_Mm02_00306621 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306622 predicted 1024
2 SASI_Mm02_00306623 predicted 1080
3 SASI_Mm02_00306624 predicted 736
4 SASI_Mm02_00306625 predicted 1069
5 SASI_Mm02_00306626 predicted 740
6 SASI_Mm02_00306627 predicted 270
7 SASI_Mm02_00306628 predicted 824
8 SASI_Mm02_00306629 predicted 772
9 SASI_Mm02_00306630 predicted 506
10 SASI_Mm02_00306631 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318775 predicted 1155
2 SASI_Mm02_00318776 predicted 1211
3 SASI_Mm02_00318777 predicted 871
4 SASI_Mm02_00318778 predicted 1201
5 SASI_Mm02_00318779 predicted 876
6 SASI_Mm02_00318780 predicted 1183
7 SASI_Mm02_00318781 predicted 958
8 SASI_Mm02_00318782 predicted 912
9 SASI_Mm01_00141996 predicted 588
10 SASI_Mm01_00141997 predicted 835
11 SASI_Mm01_00141989 predicted 211
12 SASI_Mm01_00141990 predicted 503
13 SASI_Mm01_00141991 predicted 210
14 SASI_Mm01_00141992 predicted 448
15 SASI_Mm01_00141993 predicted 485
16 SASI_Mm01_00141994 predicted 219
17 SASI_Mm01_00141995 predicted 227
18 SASI_Mm01_00141998 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350543 predicted 265
2 SASI_Mm02_00350544 predicted 306
3 SASI_Mm02_00350545 predicted 281
4 SASI_Mm01_00077459 predicted 262
5 SASI_Mm02_00350546 predicted 260
6 SASI_Mm02_00350547 predicted 290
7 SASI_Mm02_00350548 predicted 261
8 SASI_Mm02_00350549 predicted 379
9 SASI_Mm02_00350550 predicted 261
10 SASI_Mm02_00350551 predicted 280
11 SASI_Mm01_00077456 predicted 1592
12 SASI_Mm01_00077457 predicted 1792
13 SASI_Mm01_00077458 predicted 1557
14 SASI_Mm01_00077460 predicted 1561
15 SASI_Mm01_00077461 predicted 1864
16 SASI_Mm01_00077462 predicted 1668
17 SASI_Mm01_00077463 predicted 1872
18 SASI_Mm01_00077464 predicted 1880
19 SASI_Mm01_00077465 predicted 1579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010512
VALIDATED
IGF1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 1 (somatomedin C)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-957s1c1
Sequence:CCGGGCTCCATTAGACACACCCTTTCTCGAGAAAGGGTGTGTCTAATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-215s1c1
Sequence:CCGGCAGGCATTGTGGATGAGTGTTCTCGAGAACACTCATCCACAATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-249s1c1
Sequence:CCGGTGATCTGAGGAGACTGGAGATCTCGAGATCTCCAGTCTCCTCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-381s1c1
Sequence:CCGGGAAGCTGCAAAGGAGAAGGAACTCGAGTTCCTTCTCCTTTGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010512.2-354s1c1
Sequence:CCGGCCCGTCCCTATCGACAAACAACTCGAGTTGTTTGTCGATAGGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010512
VALIDATED
IGF1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 1 (somatomedin C)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-957s1c1
Sequence:CCGGGCTCCATTAGACACACCCTTTCTCGAGAAAGGGTGTGTCTAATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-215s1c1
Sequence:CCGGCAGGCATTGTGGATGAGTGTTCTCGAGAACACTCATCCACAATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-249s1c1
Sequence:CCGGTGATCTGAGGAGACTGGAGATCTCGAGATCTCCAGTCTCCTCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-381s1c1
Sequence:CCGGGAAGCTGCAAAGGAGAAGGAACTCGAGTTCCTTCTCCTTTGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010512.2-354s1c1
Sequence:CCGGCCCGTCCCTATCGACAAACAACTCGAGTTGTTTGTCGATAGGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010512
VALIDATED
IGF1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 1 (somatomedin C)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-957s1c1
Sequence:CCGGGCTCCATTAGACACACCCTTTCTCGAGAAAGGGTGTGTCTAATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-215s1c1
Sequence:CCGGCAGGCATTGTGGATGAGTGTTCTCGAGAACACTCATCCACAATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-249s1c1
Sequence:CCGGTGATCTGAGGAGACTGGAGATCTCGAGATCTCCAGTCTCCTCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010512.2-381s1c1
Sequence:CCGGGAAGCTGCAAAGGAGAAGGAACTCGAGTTCCTTCTCCTTTGCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010512.2-354s1c1
Sequence:CCGGCCCGTCCCTATCGACAAACAACTCGAGTTGTTTGTCGATAGGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000618
IGF1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 1 (somatomedin C)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000618.2-6169s1c1
Sequence:CCGGCCTCCCAAATTGCTGGGATTACTCGAGTAATCCCAGCAATTTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-598s1c1
Sequence:CCGGGAGTGCAGGAAACAAGAACTACTCGAGTAGTTCTTGTTTCCTGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-332s1c1
Sequence:CCGGGCTGAGCTGGTGGATGCTCTTCTCGAGAAGAGCATCCACCAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-226s1c1
Sequence:CCGGGAAGGTGAAGATGCACACCATCTCGAGATGGTGTGCATCTTCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-193s1c1
Sequence:CCGGCCAATTATTTAAGTGCTGCTTCTCGAGAAGCAGCACTTAAATAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.x-218s1c1
Sequence:CCGGATTTCTTGAAGGTGAAGATGCTCGAGCATCTTCACCTTCAAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000618
IGF1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 1 (somatomedin C)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000618.2-6169s1c1
Sequence:CCGGCCTCCCAAATTGCTGGGATTACTCGAGTAATCCCAGCAATTTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-598s1c1
Sequence:CCGGGAGTGCAGGAAACAAGAACTACTCGAGTAGTTCTTGTTTCCTGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-332s1c1
Sequence:CCGGGCTGAGCTGGTGGATGCTCTTCTCGAGAAGAGCATCCACCAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-226s1c1
Sequence:CCGGGAAGGTGAAGATGCACACCATCTCGAGATGGTGTGCATCTTCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-193s1c1
Sequence:CCGGCCAATTATTTAAGTGCTGCTTCTCGAGAAGCAGCACTTAAATAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.x-218s1c1
Sequence:CCGGATTTCTTGAAGGTGAAGATGCTCGAGCATCTTCACCTTCAAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000618
IGF1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 1 (somatomedin C)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000618.2-6169s1c1
Sequence:CCGGCCTCCCAAATTGCTGGGATTACTCGAGTAATCCCAGCAATTTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-598s1c1
Sequence:CCGGGAGTGCAGGAAACAAGAACTACTCGAGTAGTTCTTGTTTCCTGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-332s1c1
Sequence:CCGGGCTGAGCTGGTGGATGCTCTTCTCGAGAAGAGCATCCACCAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-226s1c1
Sequence:CCGGGAAGGTGAAGATGCACACCATCTCGAGATGGTGTGCATCTTCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.2-193s1c1
Sequence:CCGGCCAATTATTTAAGTGCTGCTTCTCGAGAAGCAGCACTTAAATAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000618.x-218s1c1
Sequence:CCGGATTTCTTGAAGGTGAAGATGCTCGAGCATCTTCACCTTCAAGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)