EMAIL THIS PAGE TO A FRIEND

IGF1R

insulin-like growth factor 1 receptor

324 Gene Product Result for
Synonyms: CD221 IGFIR IGFR JTK13
UniProtKB ID: P08069, B1B5Y2, Q14CV2, Q9UCC0
Gene ID:
Human(3480) Summary: This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. [provided by RefSeq, Jul 2008]
Mouse(16001) insulin-like growth factor I receptor
Rat(25718) insulin-like growth factor 1 receptor
sheep(443002) insulin-like growth factor 1 receptor
domestic guinea pig(100734840) insulin-like growth factor 1 receptor
naked mole-rat(101710224) insulin-like growth factor 1 receptor
chicken(395889) insulin-like growth factor 1 receptor
cow(281848) insulin-like growth factor 1 receptor
Horse(100055698) insulin-like growth factor 1 receptor
domestic cat(100500937) insulin-like growth factor 1 receptor
dog(442951) insulin-like growth factor 1 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21062 Anti-CD221 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1104892 Anti-IGF1R (771-785) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300359 Anti-IGF1R (Ab-1161) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300360 Anti-IGF1R (Ab-1165/1166) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4300548 Anti-IGF1R (Ab-1280) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4300549 Anti-IGF1R (Ab-1346) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB2101136 Anti-IGF1R antibody produced in rabbit affinity isolated antibody , pig, horse, human, rat, bovine, mouse, zebrafish
western blot pricing
HPA045563 Anti-IGF1R antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501522 Anti-IGF1R antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501523 Anti-IGF1R antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501524 Anti-IGF1R antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
I7151 Anti-Insulin-Like Growth Factor-I Receptor antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, neutralization, western blot pricing
SAB1302572 ANTI-MOUSE IGF1R (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4300652 Anti-phospho-IGF-1R (pTyr1280) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504436 Anti-phospho-IGF1R (pTyr1161) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300069 Anti-phospho-IGF1R (pTyr1165/pTyr1166) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, western blot pricing
SAB4504437 Anti-phospho-IGF1R (pTyr1165/Tyr1166) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504589 Anti-phospho-IGF1R (pTyr1346) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4301279 Anti-phospho-IGF1R (pTyr1346) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
I2033 Anti-phospho-Insulin Receptor/Insulin-Like Growth Factor-1 Receptor (pTyr1158/1162/1163) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
I2158 Anti-phospho-Insulin Receptor/Insulin-Like Growth Factor-1 Receptor (pTyr1162/1163) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunocytochemistry, western blot pricing
SAB5300081 Monoclonal Anti-IGF1R antibody produced in mouse clone 3C8B1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300082 Monoclonal Anti-IGF1R antibody produced in mouse clone 3G5C1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T7697 I-OMe-Tyrphostin AG 538 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
05-1571 Anti-IGF-1R Antibody, clone 24-57 This Anti-IGF-1R Antibody, clone 24-57 is validated for use in IH, IP for the detection of IGF-1R. pricing
MABS192 Anti-IGF-IR Antibody, clone αIR3 (Azide Free) Anti-IGF-IR Antibody, clone αIR3 (Azide Free) is an antibody against IGF-IR for use in ICC. pricing
05-656 Anti-IGF-IR Antibody, clone JBW902 Anti-IGF-IR Antibody, clone JBW902 detects level of IGF-IR & has been published & validated for use in IH, IP & WB. pricing
05-1106 Anti-IGF-IR Antibody, β-subunit, clone 1-2 Anti-IGF-IR Antibody, β-subunit, clone 1-2 is an antibody against IGF-IR for use in WB, IH(P). pricing
06-429-I Anti-IGF-IRα subunit Antibody This Anti-IGF-IRα subunit Antibody is validated for use in Western Blotting, Immunoprecipitation, Immunocytochemistry for the detection of IGF-IRα subunit. pricing
MAB1120 Anti-Insulin-like Growth Factor-1 Receptor Antibody, α-subunit, clone 24-31 Anti-Insulin-like Growth Factor-1 Receptor Antibody, α-subunit, clone 24-31 detects level of Insulin-like Growth Factor-1 Receptor & has been published & validated for use in IH(P) & IP. pricing
ABE332 Anti-phospho-IGF-1R (Tyr1161/Tyr1165/Tyr1166) Antibody Anti-phospho-IGF-1R (Tyr1161/Tyr1165/Tyr1166) Antibody is an antibody against phospho-IGF-1R (Tyr1161/Tyr1165/Tyr1166) for use in WB, Cell Function Assay. pricing
14-465-M IGF-IR (δ1-958) Protein, active, 250 µg Active, N-terminal His6-tagged, recombinant human IGF-IR residues 959-end, for use in Kinase Assays. pricing
12-527 IGF-IRtide Substrate for in vitro IGF-1R kinase assays. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000875 siRNAs that have been validated in the lab human pricing
NM_052807 Rosetta Predictions rat pricing
NM_010513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000875 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126196 validated 1593
1 SASI_Hs01_00126194 validated 3465
2 SASI_Hs01_00126195 predicted 1119
3 SASI_Hs02_00303409 predicted 2360
4 SASI_Hs02_00303410 predicted 3823
5 SASI_Hs01_00126197 predicted 1304
6 SASI_Hs01_00126198 predicted 2753
7 SASI_Hs01_00126199 predicted 1773
8 SASI_Hs01_00126200 predicted 2740
9 SASI_Hs01_00126201 predicted 2434
10 SASI_Hs01_00126202 predicted 3181
11 SASI_Hs01_00126203 predicted 3506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073475 predicted 2738
2 SASI_Rn02_00265611 predicted 414
3 SASI_Rn01_00073478 predicted 1140
4 SASI_Rn01_00073479 predicted 2432
5 SASI_Rn01_00073480 predicted 3350
6 SASI_Rn02_00265612 predicted 2193
7 SASI_Rn01_00073481 predicted 1948
8 SASI_Rn01_00073483 predicted 2729
9 SASI_Rn01_00073484 predicted 1061
10 SASI_Rn02_00265613 predicted 2364
11 SASI_Rn01_00073476 predicted 2430
12 SASI_Rn01_00073477 predicted 2838
13 SASI_Rn01_00073482 predicted 2015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090886 predicted 3299
2 SASI_Mm01_00090887 predicted 2989
3 SASI_Mm01_00090888 predicted 3696
4 SASI_Mm01_00090890 predicted 1804
5 SASI_Mm01_00090891 predicted 3910
6 SASI_Mm02_00318783 predicted 2670
7 SASI_Mm01_00090892 predicted 3288
8 SASI_Mm01_00090893 predicted 3597
9 SASI_Mm01_00090894 predicted 2242
10 SASI_Mm01_00090895 predicted 1699
11 SASI_Mm01_00090889 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000875
VALIDATED
IGF1R MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 1 receptor
Human
26 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4308s1c1
Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-2009s1c1
Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-2995s1c1
Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-3364s1c1
Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4369s1c1
Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-1886s1c1
Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-999s1c1
Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-2427s1c1
Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1400s1c1
Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-3475s1c1
Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4484s1c1
Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3996s1c1
Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-633s1c1
Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-1959s1c1
Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3879s1c1
Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1095s1c1
Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2359s1c1
Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1113s1c1
Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-532s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4648s1c1
Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4159s1c1
Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2907s1c1
Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2914s1c1
Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-402s1c1
Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000875.2-3780s1c1
Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000875.2-4404s1c1
Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000875
VALIDATED
IGF1R MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 1 receptor
Human
26 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4308s1c1
Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-2009s1c1
Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-2995s1c1
Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-3364s1c1
Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4369s1c1
Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-1886s1c1
Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-999s1c1
Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-2427s1c1
Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1400s1c1
Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-3475s1c1
Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4484s1c1
Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3996s1c1
Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-633s1c1
Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-1959s1c1
Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3879s1c1
Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1095s1c1
Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2359s1c1
Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1113s1c1
Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-532s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4648s1c1
Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4159s1c1
Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2907s1c1
Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2914s1c1
Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-402s1c1
Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000875.2-3780s1c1
Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000875.2-4404s1c1
Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000875
VALIDATED
IGF1R MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 1 receptor
Human
26 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4308s1c1
Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-2009s1c1
Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-2995s1c1
Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-3364s1c1
Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.x-4369s1c1
Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000875.x-1886s1c1
Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.x-999s1c1
Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-2427s1c1
Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1400s1c1
Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-3475s1c1
Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4484s1c1
Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3996s1c1
Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-633s1c1
Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-1959s1c1
Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-3879s1c1
Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1095s1c1
Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2359s1c1
Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-1113s1c1
Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000875.2-532s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4648s1c1
Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121192    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000875.2-4159s1c1
Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2907s1c1
Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-2914s1c1
Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000875.2-402s1c1
Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000875.2-3780s1c1
Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000875.2-4404s1c1
Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010513
VALIDATED
IGF1R MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 1 receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1332s1c1
Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1914s1c1
Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-487s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3300s1c1
Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3656s1c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-1963s21c1
Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010513.2-4790s21c1
Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-3275s21c1
Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-4258s21c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-2878s21c1
Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010513
VALIDATED
IGF1R MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 1 receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1332s1c1
Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1914s1c1
Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-487s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3300s1c1
Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3656s1c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-1963s21c1
Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010513.2-4790s21c1
Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-3275s21c1
Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-4258s21c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-2878s21c1
Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010513
VALIDATED
IGF1R MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 1 receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1332s1c1
Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-1914s1c1
Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010513.1-487s1c1
Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3300s1c1
Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010513.1-3656s1c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-1963s21c1
Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010513.2-4790s21c1
Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-3275s21c1
Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-4258s21c1
Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010513.2-2878s21c1
Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)