IGF1R

insulin-like growth factor 1 receptor

313 Gene Product Result for

Synonyms: CD221 IGFIR IGFR JTK13

Species: Human IGF1R(3480), Mouse Igf1r(16001), Rat Igf1r(25718), sheep IGF1R(443002), domestic guinea pig Igf1r(100734840), naked mole-rat Igf1r(101710224), chicken IGF1R(395889), cow IGF1R(281848), Horse IGF1R(100055698), domestic cat IGF1R(100500937), dog IGF1R(442951)

UniProtKB ID: P08069, B1B5Y2, Q14CV2, Q9UCC0

Gene ID:

Human(3480) Summary: This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. [provided by RefSeq, Jul 2008]

Mouse(16001) insulin-like growth factor I receptor

Rat(25718) insulin-like growth factor 1 receptor

sheep(443002) insulin-like growth factor 1 receptor

domestic guinea pig(100734840) insulin-like growth factor 1 receptor

naked mole-rat(101710224) insulin-like growth factor 1 receptor

chicken(395889) insulin-like growth factor 1 receptor

cow(281848) insulin-like growth factor 1 receptor

Horse(100055698) insulin-like growth factor 1 receptor

domestic cat(100500937) insulin-like growth factor 1 receptor

dog(442951) insulin-like growth factor 1 receptor

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

GW21062	Anti-CD221 antibody produced in chicken affinity isolated antibody, buffered aqueous solution	human	western blot	pricing

05-1571	Anti-IGF-1R Antibody, clone 24-57 clone 24-57, from mouse	human	immunohistochemistry, immunoprecipitation (IP)	pricing

05-1106	Anti-IGF-IR Antibody, β-subunit, clone 1-2 clone 1-2, from mouse, purified by affinity chromatography	rat, human, mouse, mouse, rat	immunohistochemistry, western blot	pricing

MABS192	Anti-IGF-IR Antibody, clone αIR3 (Azide Free) clone αIR3, from mouse	human	immunocytochemistry	pricing

05-656	Anti-IGF-IR Antibody, clone JBW902 clone JBW902, Upstate^®, from mouse	mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

06-429-I	Anti-IGF-IRα subunit Antibody clone, from chicken, purified by affinity chromatography	human, human, human	immunocytochemistry, immunoprecipitation (IP), western blot	pricing

SAB4300359	Anti-IGF1R (Ab-1161) antibody produced in rabbit affinity isolated antibody	human, rat, mouse	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4300360	Anti-IGF1R (Ab-1165/1166) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	western blot	pricing

SAB4300548	Anti-IGF1R (Ab-1280) antibody produced in rabbit affinity isolated antibody	mouse, human	immunohistochemistry, western blot	pricing

SAB4300549	Anti-IGF1R (Ab-1346) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	immunohistochemistry, western blot	pricing

SAB5700614	Anti-IGF1R antibody produced in rabbit	human, mouse, rat	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4501522	Anti-IGF1R antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunohistochemistry, western blot	pricing

HPA045563	Anti-IGF1R antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB4501523	Anti-IGF1R antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, western blot	pricing

SAB4501524	Anti-IGF1R antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, immunohistochemistry, western blot	pricing

SAB2101136	Anti-IGF1R antibody produced in rabbit affinity isolated antibody	bovine, human, sheep, dog, pig, horse	immunofluorescence, immunohistochemistry, western blot	pricing

MAB1120	Anti-Insulin-like Growth Factor-1 Receptor Antibody, α-subunit, clone 24-31 clone 24-31, Chemicon^®, from mouse	human	immunohistochemistry, immunoprecipitation (IP)	pricing

I7151	Anti-Insulin-Like Growth Factor-I Receptor antibody produced in goat affinity isolated antibody, lyophilized powder	human	ELISA, neutralization, western blot	pricing

SAB4300652	Anti-phospho-IGF-1R (pTyr¹²⁸⁰) antibody produced in rabbit affinity isolated antibody	human	western blot	pricing

ABE332	Anti-phospho-IGF-1R (Tyr1161/Tyr1165/Tyr1166) Antibody clone, from rabbit, purified by affinity chromatography	human, pig, mouse, rat, chicken, Xenopus, human	cell analysis, western blot	pricing

SAB4504436	Anti-phospho-IGF1R (pTyr¹¹⁶¹) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunohistochemistry, western blot	pricing

SAB4300069	Anti-phospho-IGF1R (pTyr¹¹⁶⁵/pTyr¹¹⁶⁶) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	immunofluorescence, western blot	pricing

SAB4504437	Anti-phospho-IGF1R (pTyr¹¹⁶⁵/Tyr¹¹⁶⁶) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, western blot	pricing

SAB4504589	Anti-phospho-IGF1R (pTyr¹³⁴⁶) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunohistochemistry	pricing

SAB4301279	Anti-phospho-IGF1R (pTyr¹³⁴⁶) antibody produced in rabbit affinity isolated antibody	human	immunohistochemistry	pricing

SAB5700530	Anti-Phospho-IGF1R-Y1165/1166/INSR-Y1189/1190 antibody produced in rabbit	human, rat, mouse	western blot	pricing

SAB5700587	Anti-Phospho-INSR-Y1189/Y1190 + IGF1R-Y1165/Y1166 antibody produced in rabbit	human, rat, mouse	western blot	pricing

I2033	Anti-phospho-Insulin Receptor/Insulin-Like Growth Factor-1 Receptor (pTyr¹¹⁵⁸/^1162/1163) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	western blot	pricing

I2158	Anti-phospho-Insulin Receptor/Insulin-Like Growth Factor-1 Receptor (pTyr^1162/1163) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human, rat	immunocytochemistry, western blot	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

BM0003	BMS-754807 ≥98% (HPLC)	human	pricing

T7697	I-OMe-Tyrphostin AG 538 solid	human	pricing

T9576	Picropodophyllotoxin ≥96% (HPLC), powder	human	pricing

Small Molecule - Substrate

Product #	Description	Species	Add to Cart

12-527	IGF-IRtide Substrate for in vitro IGF-1R kinase assays.	human	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP6495	IGF 1R/CD221 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE)	human	pricing

14-465-M	IGF-IR (δ1-958) Protein, active, 20 µg Active, N-terminal His6-tagged, recombinant human IGF-IR residues 959-end, for use in Kinase Assays.	human	pricing

I0786	IGF1R (960-end), active, His tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

I4657	Insulin-like Growth Factor-I Receptor human ≥95% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder	human	pricing

APREST87460	PrEST Antigen IGF1R Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

S1820	Ser-Phe-Leu-Leu-Arg-Asn-amide trifluoroacetate salt ≥98% (HPLC), lyophilized powder	human	pricing

QPREST22804	SILu^™PrEST IGF1R SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0230	Human IGF-I R ELISA Kit for serum, plasma, cell culture supernatant and urine	human	pricing

RAB0800	Mouse Igf1r / Insulin-like Growth Factor 1 Receptor ELISA Kit	mouse	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_000875	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_000875	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_000875	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_010513	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_010513	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_010513	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU028861	MISSION^® esiRNA targeting human IGF1R	human	pricing

EMU017201	MISSION^® esiRNA targeting mouse Igf1r	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_000875	siRNAs that have been validated in the lab	human	pricing
NM_052807	Rosetta Predictions	rat	pricing
NM_010513	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_000875	siRNAs that have been validated in the lab	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00126196 validated	1593
1	SASI_Hs01_00126194 validated	3465
2	SASI_Hs01_00126195 predicted	1119
3	SASI_Hs02_00303409 predicted	2360
4	SASI_Hs02_00303410 predicted	3823
5	SASI_Hs01_00126197 predicted	1304
6	SASI_Hs01_00126198 predicted	2753
7	SASI_Hs01_00126199 predicted	1773
8	SASI_Hs01_00126200 predicted	2740
9	SASI_Hs01_00126201 predicted	2434
10	SASI_Hs01_00126202 predicted	3181
11	SASI_Hs01_00126203 predicted	3506

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_052807	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00073475 predicted	2738
2	SASI_Rn02_00265611 predicted	414
3	SASI_Rn01_00073478 predicted	1140
4	SASI_Rn01_00073479 predicted	2432
5	SASI_Rn01_00073480 predicted	3350
6	SASI_Rn02_00265612 predicted	2193
7	SASI_Rn01_00073481 predicted	1948
8	SASI_Rn01_00073483 predicted	2729
9	SASI_Rn01_00073484 predicted	1061
10	SASI_Rn02_00265613 predicted	2364
11	SASI_Rn01_00073476 predicted	2430
12	SASI_Rn01_00073477 predicted	2838
13	SASI_Rn01_00073482 predicted	2015

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_010513	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00090886 predicted	3299
2	SASI_Mm01_00090887 predicted	2989
3	SASI_Mm01_00090888 predicted	3696
4	SASI_Mm01_00090890 predicted	1804
5	SASI_Mm01_00090891 predicted	3910
6	SASI_Mm02_00318783 predicted	2670
7	SASI_Mm01_00090892 predicted	3288
8	SASI_Mm01_00090893 predicted	3597
9	SASI_Mm01_00090894 predicted	2242
10	SASI_Mm01_00090895 predicted	1699
11	SASI_Mm01_00090889 predicted	378

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_000875 VALIDATED	IGF1R MISSION shRNA Bacterial Glycerol Stock insulin-like growth factor 1 receptor	Human

27 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121300
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-633s1c1
	Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121132
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4648s1c1
	Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010361
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4308s1c1
	Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000424
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-2995s1c1
	Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-3364s1c1
	Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-1886s1c1
	Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000423
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-2009s1c1
	Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121297
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4484s1c1
	Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121298
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3996s1c1
	Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121301
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-1959s1c1
	Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121195
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2914s1c1
	Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121192
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4159s1c1
	Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121136
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1095s1c1
	Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121135
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2359s1c1
	Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121134
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1113s1c1
	Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-532s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121196
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2907s1c1
	Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121193
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-402s1c1
	Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121299
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3879s1c1
	Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039677
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2427s1c1
	Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039675
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-3475s1c1
	Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039676
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1400s1c1
	Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000018331
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-999s1c1
	Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039674
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2020s1c1
	Sequence:CCGGCGGCACAATTACTGCTCCAAACTCGAGTTTGGAGCAGTAATTGTGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000422
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4369s1c1
	Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195002
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4404s1c1
	Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3780s1c1
	Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_000875 VALIDATED	IGF1R MISSION shRNA shRNA Plasmid DNA insulin-like growth factor 1 receptor	Human

27 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121300
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-633s1c1
	Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121132
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4648s1c1
	Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000010361
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4308s1c1
	Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000424
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-2995s1c1
	Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-3364s1c1
	Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-1886s1c1
	Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000423
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-2009s1c1
	Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121297
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4484s1c1
	Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121298
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3996s1c1
	Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121301
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-1959s1c1
	Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121195
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2914s1c1
	Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121192
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4159s1c1
	Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121136
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1095s1c1
	Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121135
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2359s1c1
	Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121134
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1113s1c1
	Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-532s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121196
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2907s1c1
	Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121193
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-402s1c1
	Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000121299
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3879s1c1
	Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039677
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2427s1c1
	Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039675
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-3475s1c1
	Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039676
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1400s1c1
	Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000018331
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-999s1c1
	Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039674
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2020s1c1
	Sequence:CCGGCGGCACAATTACTGCTCCAAACTCGAGTTTGGAGCAGTAATTGTGCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000000422
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4369s1c1
	Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195002
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4404s1c1
	Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000199517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3780s1c1
	Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_000875 VALIDATED	IGF1R MISSION shRNA Lentiviral Transduction Particles insulin-like growth factor 1 receptor	Human

27 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000121300
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-633s1c1
	Sequence:CCGGCATCAACAATGAGTACAACTACTCGAGTAGTTGTACTCATTGTTGATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121132
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4648s1c1
	Sequence:CCGGCCTTTATCTTTCACCTTTCTACTCGAGTAGAAAGGTGAAAGATAAAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000010361
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4308s1c1
	Sequence:CCGGAAACACATTTGGGATGTTCCTCTCGAGAGGAACATCCCAAATGTGTTTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000424
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-2995s1c1
	Sequence:CCGGGCTGATGTGTACGTTCCTGATCTCGAGATCAGGAACGTACACATCAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000426
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-3364s1c1
	Sequence:CCGGCCAAGCCTGAGCAAGATGATTCTCGAGAATCATCTTGCTCAGGCTTGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000425
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_000875.x-1886s1c1
	Sequence:CCGGCCTTGGACGTTCTTTCAGCATCTCGAGATGCTGAAAGAACGTCCAAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000423
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-2009s1c1
	Sequence:CCGGGCTACCTTTACCGGCACAATTCTCGAGAATTGTGCCGGTAAAGGTAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121297
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4484s1c1
	Sequence:CCGGCCTCTCTGCTTCATAACGGAACTCGAGTTCCGTTATGAAGCAGAGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121298
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3996s1c1
	Sequence:CCGGCGACAGACACTCAGGACACAACTCGAGTTGTGTCCTGAGTGTCTGTCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121301
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-1959s1c1
	Sequence:CCGGCGGCAACCTGAGTTACTACATCTCGAGATGTAGTAACTCAGGTTGCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121195
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2914s1c1
	Sequence:CCGGGTCTTCCATAGAAAGAGAAATCTCGAGATTTCTCTTTCTATGGAAGACTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121192
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4159s1c1
	Sequence:CCGGCCTGAATCTGTGCAAACAGTACTCGAGTACTGTTTGCACAGATTCAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121136
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1095s1c1
	Sequence:CCGGCCAAGGATGCACCATCTTCAACTCGAGTTGAAGATGGTGCATCCTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121135
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2359s1c1
	Sequence:CCGGGAGACAGAGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACTCTGTCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121134
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1113s1c1
	Sequence:CCGGCAAGGGCAATTTGCTCATTAACTCGAGTTAATGAGCAAATTGCCCTTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121133
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-532s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121196
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-2907s1c1
	Sequence:CCGGGCTGTACGTCTTCCATAGAAACTCGAGTTTCTATGGAAGACGTACAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121193
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-402s1c1
	Sequence:CCGGCTTCGAGATGACCAATCTCAACTCGAGTTGAGATTGGTCATCTCGAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000121299
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3879s1c1
	Sequence:CCGGCTTCTACTACAGCGAGGAGAACTCGAGTTCTCCTCGCTGTAGTAGAAGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039677
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2427s1c1
	Sequence:CCGGGCCTTTCACATTGTACCGCATCTCGAGATGCGGTACAATGTGAAAGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039675
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-3475s1c1
	Sequence:CCGGGCCGAAGATTTCACAGTCAAACTCGAGTTTGACTGTGAAATCTTCGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039676
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-1400s1c1
	Sequence:CCGGCCAAATTATGTGTTTCCGAAACTCGAGTTTCGGAAACACATAATTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000018331
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.x-999s1c1
	Sequence:CCGGCATGTACTGCATCCCTTGTGACTCGAGTCACAAGGGATGCAGTACATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039674
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: MCF7
	TRC Version: 1	Clone ID:NM_000875.2-2020s1c1
	Sequence:CCGGCGGCACAATTACTGCTCCAAACTCGAGTTTGGAGCAGTAATTGTGCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000000422
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.x-4369s1c1
	Sequence:CCGGCCTTAACTGACATGGGCCTTTCTCGAGAAAGGCCCATGTCAGTTAAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195002
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_000875.2-4404s1c1
	Sequence:CCGGCAACACTTAATAGCAACAGAGCTCGAGCTCTGTTGCTATTAAGTGTTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000199517
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_000875.2-3780s1c1
	Sequence:CCGGGCGCATGTGCTGGCAGTATAACTCGAGTTATACTGCCAGCACATGCGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_010513 VALIDATED	IGF1R MISSION shRNA Bacterial Glycerol Stock insulin-like growth factor 1 receptor	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000023492
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1914s1c1
	Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321981
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-3275s21c1
	Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023491
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1332s1c1
	Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023493
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3656s1c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023490
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3300s1c1
	Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023489
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-487s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350660
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-1963s21c1
	Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321979
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010513.2-4790s21c1
	Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-2878s21c1
	Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321978
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-4258s21c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_010513 VALIDATED	IGF1R MISSION shRNA shRNA Plasmid DNA insulin-like growth factor 1 receptor	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000023492
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1914s1c1
	Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321981
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-3275s21c1
	Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023491
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1332s1c1
	Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023493
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3656s1c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023490
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3300s1c1
	Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000023489
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-487s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000350660
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-1963s21c1
	Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321979
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010513.2-4790s21c1
	Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-2878s21c1
	Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000321978
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-4258s21c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_010513 VALIDATED	IGF1R MISSION shRNA Lentiviral Transduction Particles insulin-like growth factor 1 receptor	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000023492
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1914s1c1
	Sequence:CCGGCAATGGTAACTTGAGTTACTACTCGAGTAGTAACTCAAGTTACCATTGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321981
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-3275s21c1
	Sequence:CCGGGGCCAAACTCAACCGTCTAAACTCGAGTTTAGACGGTTGAGTTTGGCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023491
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-1332s1c1
	Sequence:CCGGCGGAAAGATGTACTTTGCTTTCTCGAGAAAGCAAAGTACATCTTTCCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023493
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.73	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3656s1c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023490
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: 3T3-L1
	TRC Version: 1	Clone ID:NM_010513.1-3300s1c1
	Sequence:CCGGGCAGAATAATCTAGTCCTCATCTCGAGATGAGGACTAGATTATTCTGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000023489
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_010513.1-487s1c1
	Sequence:CCGGGCGGTGTCCAATAACTACATTCTCGAGAATGTAGTTATTGGACACCGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000350660
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-1963s21c1
	Sequence:CCGGAGCTGTGTGTCTCCGAAATTTCTCGAGAAATTTCGGAGACACACAGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321979
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_010513.2-4790s21c1
	Sequence:CCGGAGCAGGTTGTAACAATCTATTCTCGAGAATAGATTGTTACAACCTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321972
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-2878s21c1
	Sequence:CCGGCGGTAGCTGACACCTACAATACTCGAGTATTGTAGGTGTCAGCTACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000321978
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010513.2-4258s21c1
	Sequence:CCGGCCAACGAGCAAGTTCTTCGTTCTCGAGAACGAAGAACTTGCTCGTTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart