EMAIL THIS PAGE TO A FRIEND

IGF2-AS

IGF2 antisense RNA

27 Gene Product Result for
Synonyms: IGF2-AS1 IGF2AS PEG8
Species: Human IGF2-AS(51214)
UniProtKB ID: Q6U949, A5PKV8, A6NNQ2, Q7Z712, Q9P2W0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302447 ANTI-IGF2AS (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016412 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064990 predicted 557
2 SASI_Hs02_00349432 predicted 952
3 SASI_Hs01_00064991 predicted 639
4 SASI_Hs01_00064992 predicted 639
5 SASI_Hs01_00064993 predicted 594
6 SASI_Hs01_00064994 predicted 1377
7 SASI_Hs01_00064995 predicted 1956
8 SASI_Hs02_00349433 predicted 1177
9 SASI_Hs01_00064997 predicted 1322
10 SASI_Hs01_00064998 predicted 1648
11 SASI_Hs01_00064996 predicted 1952
12 SASI_Hs01_00064999 predicted 1487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016412
IGF2-AS MISSION shRNA Bacterial Glycerol Stock
IGF2 antisense RNA
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-630s21c1
Sequence:CCGGCGGCCTGGGAAGTAGGACTAACTCGAGTTAGTCCTACTTCCCAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-494s21c1
Sequence:CCGGTACAAACCCAGCTCCTTTCTCCTCGAGGAGAAAGGAGCTGGGTTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-506s21c1
Sequence:CCGGTCCTTTCTCCAAGGGTCCTCACTCGAGTGAGGACCCTTGGAGAAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-641s21c1
Sequence:CCGGGTAGGACTAAGGACCCGAACTCTCGAGAGTTCGGGTCCTTAGTCCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016412.2-1384s21c1
Sequence:CCGGAGCTCCCTCTTTCAAAGTATACTCGAGTATACTTTGAAAGAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016412
IGF2-AS MISSION shRNA shRNA Plasmid DNA
IGF2 antisense RNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-630s21c1
Sequence:CCGGCGGCCTGGGAAGTAGGACTAACTCGAGTTAGTCCTACTTCCCAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-494s21c1
Sequence:CCGGTACAAACCCAGCTCCTTTCTCCTCGAGGAGAAAGGAGCTGGGTTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-506s21c1
Sequence:CCGGTCCTTTCTCCAAGGGTCCTCACTCGAGTGAGGACCCTTGGAGAAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-641s21c1
Sequence:CCGGGTAGGACTAAGGACCCGAACTCTCGAGAGTTCGGGTCCTTAGTCCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016412.2-1384s21c1
Sequence:CCGGAGCTCCCTCTTTCAAAGTATACTCGAGTATACTTTGAAAGAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016412
IGF2-AS MISSION shRNA Lentiviral Transduction Particles
IGF2 antisense RNA
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-630s21c1
Sequence:CCGGCGGCCTGGGAAGTAGGACTAACTCGAGTTAGTCCTACTTCCCAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-494s21c1
Sequence:CCGGTACAAACCCAGCTCCTTTCTCCTCGAGGAGAAAGGAGCTGGGTTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-506s21c1
Sequence:CCGGTCCTTTCTCCAAGGGTCCTCACTCGAGTGAGGACCCTTGGAGAAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016412.2-641s21c1
Sequence:CCGGGTAGGACTAAGGACCCGAACTCTCGAGAGTTCGGGTCCTTAGTCCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016412.2-1384s21c1
Sequence:CCGGAGCTCCCTCTTTCAAAGTATACTCGAGTATACTTTGAAAGAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)