EMAIL THIS PAGE TO A FRIEND

IGF2BP1

insulin-like growth factor 2 mRNA binding protein 1

358 Gene Product Result for
Synonyms: CRD-BP CRDBP IMP-1 IMP1 VICKZ1 ZBP1
UniProtKB ID: Q9NZI8, C9JT33
Gene ID:
Human(10642) Summary: This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(140486) insulin-like growth factor 2 mRNA binding protein 1
Rat(303477) insulin-like growth factor 2 mRNA binding protein 1
Zebrafish(558182) insulin-like growth factor 2 mRNA binding protein 1
dog(491064) insulin-like growth factor 2 mRNA binding protein 1
domestic cat(101096428) insulin-like growth factor 2 mRNA binding protein 1
cow(516853) insulin-like growth factor 2 mRNA binding protein 1
Horse(100055918) insulin-like growth factor 2 mRNA binding protein 1
chicken(395953) insulin-like growth factor 2 mRNA binding protein 1
domestic guinea pig(100718298) insulin-like growth factor 2 mRNA binding protein 1
naked mole-rat(101718854) insulin-like growth factor 2 mRNA binding protein 1
sheep(101113253) insulin-like growth factor 2 mRNA binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006546 Rosetta Predictions human pricing
NM_175594 Rosetta Predictions rat pricing
NM_009951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074473 predicted 939
2 SASI_Hs01_00074474 predicted 636
3 SASI_Hs01_00074475 predicted 1731
4 SASI_Hs01_00074476 predicted 1677
5 SASI_Hs01_00074477 predicted 1961
6 SASI_Hs01_00074478 predicted 1096
7 SASI_Hs01_00074479 predicted 1361
8 SASI_Hs01_00074480 predicted 1119
9 SASI_Hs02_00341809 predicted 2018
10 SASI_Hs01_00074481 predicted 1757
11 SASI_Hs01_00074482 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269493 predicted 625
2 SASI_Rn01_00120365 predicted 1564
3 SASI_Rn01_00120366 predicted 1183
4 SASI_Rn01_00120367 predicted 986
5 SASI_Rn01_00120369 predicted 679
6 SASI_Rn01_00120370 predicted 1177
7 SASI_Rn01_00120371 predicted 643
8 SASI_Rn01_00120372 predicted 1627
9 SASI_Rn01_00120373 predicted 1532
10 SASI_Rn01_00120374 predicted 1093
11 SASI_Rn01_00120368 predicted 1821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169783 predicted 719
2 SASI_Mm01_00169784 predicted 1963
3 SASI_Mm01_00169785 predicted 916
4 SASI_Mm01_00169786 predicted 1660
5 SASI_Mm01_00169787 predicted 1080
6 SASI_Mm01_00169788 predicted 1287
7 SASI_Mm01_00169789 predicted 1260
8 SASI_Mm01_00169790 predicted 1411
9 SASI_Mm01_00169791 predicted 769
10 SASI_Mm01_00169792 predicted 1779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009951
VALIDATED
IGF2BP1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-675s21c1
Sequence:CCGGGTCAACGTCACCTACTCTAACCTCGAGGTTAGAGTAGGTGACGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-400s21c1
Sequence:CCGGGCGGCCAGTTCTTGGTCAAATCTCGAGATTTGACCAAGAACTGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1973s21c1
Sequence:CCGGAGACATCCTGGCTCAAGTTAACTCGAGTTAACTTGAGCCAGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-1907s21c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1644s21c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-1676s1c1
Sequence:CCGGCCAGGGAAGAATCTATGGCAACTCGAGTTGCCATAGATTCTTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009951.2-2404s1c1
Sequence:CCGGCCTCCAAATCTTTCTAACCTTCTCGAGAAGGTTAGAAAGATTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1611s1c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1874s1c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-890s1c1
Sequence:CCGGGCAGTATGTAGGCGCTATCATCTCGAGATGATAGCGCCTACATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-587s21c1
Sequence:CCGGCCGATGGGAAGTGCTAGATAGCTCGAGCTATCTAGCACTTCCCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009951
VALIDATED
IGF2BP1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-675s21c1
Sequence:CCGGGTCAACGTCACCTACTCTAACCTCGAGGTTAGAGTAGGTGACGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-400s21c1
Sequence:CCGGGCGGCCAGTTCTTGGTCAAATCTCGAGATTTGACCAAGAACTGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1973s21c1
Sequence:CCGGAGACATCCTGGCTCAAGTTAACTCGAGTTAACTTGAGCCAGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-1907s21c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1644s21c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-1676s1c1
Sequence:CCGGCCAGGGAAGAATCTATGGCAACTCGAGTTGCCATAGATTCTTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009951.2-2404s1c1
Sequence:CCGGCCTCCAAATCTTTCTAACCTTCTCGAGAAGGTTAGAAAGATTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1611s1c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1874s1c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-890s1c1
Sequence:CCGGGCAGTATGTAGGCGCTATCATCTCGAGATGATAGCGCCTACATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-587s21c1
Sequence:CCGGCCGATGGGAAGTGCTAGATAGCTCGAGCTATCTAGCACTTCCCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009951
VALIDATED
IGF2BP1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-675s21c1
Sequence:CCGGGTCAACGTCACCTACTCTAACCTCGAGGTTAGAGTAGGTGACGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-400s21c1
Sequence:CCGGGCGGCCAGTTCTTGGTCAAATCTCGAGATTTGACCAAGAACTGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1973s21c1
Sequence:CCGGAGACATCCTGGCTCAAGTTAACTCGAGTTAACTTGAGCCAGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-1907s21c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009951.4-1644s21c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-1676s1c1
Sequence:CCGGCCAGGGAAGAATCTATGGCAACTCGAGTTGCCATAGATTCTTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009951.2-2404s1c1
Sequence:CCGGCCTCCAAATCTTTCTAACCTTCTCGAGAAGGTTAGAAAGATTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1611s1c1
Sequence:CCGGGAAACACCTGACTCCAAAGTTCTCGAGAACTTTGGAGTCAGGTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009951.2-1874s1c1
Sequence:CCGGCGACCAAGTCATTGTTAAGATCTCGAGATCTTAACAATGACTTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009951.2-890s1c1
Sequence:CCGGGCAGTATGTAGGCGCTATCATCTCGAGATGATAGCGCCTACATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009951.4-587s21c1
Sequence:CCGGCCGATGGGAAGTGCTAGATAGCTCGAGCTATCTAGCACTTCCCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006546
VALIDATED
IGF2BP1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-532s21c1
Sequence:GTACCGGACGCTTAGAGATTGAACATTCCTCGAGGAATGTTCAATCTCTAAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1678s21c1
Sequence:GTACCGGCTCCAAAGTTCGTATGGTTATCTCGAGATAACCATACGAACTTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-6962s21c1
Sequence:CCGGGATGGATGCTACGAGTATAAACTCGAGTTTATACTCGTAGCATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1170s21c1
Sequence:CCGGTGAAGATCCTGGCCCATAATACTCGAGTATTATGGGCCAGGATCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-1177s1c1
Sequence:CCGGCCTGGCCCATAATAACTTTGTCTCGAGACAAAGTTATTATGGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-380s1c1
Sequence:CCGGGCGGACTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006546.3-1096s1c1
Sequence:CCGGCTCCGCTTGTAAGATGATCTTCTCGAGAAGATCATCTTACAAGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_006546.3-692s1c1
Sequence:CCGGGCAGTGGTGAATGTCACCTATCTCGAGATAGGTGACATTCACCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006546.3-8085s1c1
Sequence:CCGGCCAGGAATAAAGGCTTTGTTTCTCGAGAAACAAAGCCTTTATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006546.3-694s21c1
Sequence:CCGGAGTGGTGAATGTCACCTATTCCTCGAGGAATAGGTGACATTCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006546
VALIDATED
IGF2BP1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-532s21c1
Sequence:GTACCGGACGCTTAGAGATTGAACATTCCTCGAGGAATGTTCAATCTCTAAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1678s21c1
Sequence:GTACCGGCTCCAAAGTTCGTATGGTTATCTCGAGATAACCATACGAACTTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-6962s21c1
Sequence:CCGGGATGGATGCTACGAGTATAAACTCGAGTTTATACTCGTAGCATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1170s21c1
Sequence:CCGGTGAAGATCCTGGCCCATAATACTCGAGTATTATGGGCCAGGATCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-1177s1c1
Sequence:CCGGCCTGGCCCATAATAACTTTGTCTCGAGACAAAGTTATTATGGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-380s1c1
Sequence:CCGGGCGGACTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006546.3-1096s1c1
Sequence:CCGGCTCCGCTTGTAAGATGATCTTCTCGAGAAGATCATCTTACAAGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_006546.3-692s1c1
Sequence:CCGGGCAGTGGTGAATGTCACCTATCTCGAGATAGGTGACATTCACCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006546.3-8085s1c1
Sequence:CCGGCCAGGAATAAAGGCTTTGTTTCTCGAGAAACAAAGCCTTTATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006546.3-694s21c1
Sequence:CCGGAGTGGTGAATGTCACCTATTCCTCGAGGAATAGGTGACATTCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006546
VALIDATED
IGF2BP1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-532s21c1
Sequence:GTACCGGACGCTTAGAGATTGAACATTCCTCGAGGAATGTTCAATCTCTAAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1678s21c1
Sequence:GTACCGGCTCCAAAGTTCGTATGGTTATCTCGAGATAACCATACGAACTTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-6962s21c1
Sequence:CCGGGATGGATGCTACGAGTATAAACTCGAGTTTATACTCGTAGCATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006546.3-1170s21c1
Sequence:CCGGTGAAGATCCTGGCCCATAATACTCGAGTATTATGGGCCAGGATCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-1177s1c1
Sequence:CCGGCCTGGCCCATAATAACTTTGTCTCGAGACAAAGTTATTATGGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006546.3-380s1c1
Sequence:CCGGGCGGACTTGGAGAAAGTGTTTCTCGAGAAACACTTTCTCCAAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006546.3-1096s1c1
Sequence:CCGGCTCCGCTTGTAAGATGATCTTCTCGAGAAGATCATCTTACAAGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_006546.3-692s1c1
Sequence:CCGGGCAGTGGTGAATGTCACCTATCTCGAGATAGGTGACATTCACCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006546.3-8085s1c1
Sequence:CCGGCCAGGAATAAAGGCTTTGTTTCTCGAGAAACAAAGCCTTTATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006546.3-694s21c1
Sequence:CCGGAGTGGTGAATGTCACCTATTCCTCGAGGAATAGGTGACATTCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)