EMAIL THIS PAGE TO A FRIEND

IGF2BP2

insulin-like growth factor 2 mRNA binding protein 2

194 Gene Product Result for
Synonyms: IMP-2 IMP2 VICKZ2 p62
UniProtKB ID: Q9Y6M1, A0A4Z0, B3FTN2, B3FTN3, B3FTN4
Gene ID:
Human(10644) Summary: This gene encodes a member of the IGF-II mRNA-binding protein (IMP) family. The protein encoded by this gene contains several four KH domains and two RRM domains. It functions by binding to the 5' UTR of the insulin-like growth factor 2 (IGF2) mRNA and regulating IGF2 translation. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(319765) insulin-like growth factor 2 mRNA binding protein 2
Rat(303824) insulin-like growth factor 2 mRNA binding protein 2
sheep(101115925) insulin-like growth factor 2 mRNA binding protein 2
Domestic Rabbit(100344927) insulin-like growth factor 2 mRNA binding protein 2
domestic guinea pig(100733823) insulin-like growth factor 2 mRNA binding protein 2
naked mole-rat(101710981) insulin-like growth factor 2 mRNA binding protein 2
chicken(424865) insulin-like growth factor 2 mRNA binding protein 2
domestic cat(101082772) insulin-like growth factor 2 mRNA binding protein 2
cow(519028) insulin-like growth factor 2 mRNA binding protein 2
dog(478662) insulin-like growth factor 2 mRNA binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006548 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088511 MISSION® esiRNA esiRNA targeting mouse Igf2bp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007225 Rosetta Predictions human pricing
NM_006548 Rosetta Predictions human pricing
XM_001057936 Rosetta Predictions rat pricing
XM_221343 Rosetta Predictions rat pricing
NM_183029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166607 predicted 286
2 SASI_Hs01_00166608 predicted 278
3 SASI_Hs01_00166609 predicted 1545
4 SASI_Hs01_00166610 predicted 282
5 SASI_Hs01_00166611 predicted 385
6 SASI_Hs01_00166612 predicted 703
7 SASI_Hs01_00166613 predicted 1630
8 SASI_Hs01_00166614 predicted 427
9 SASI_Hs01_00166615 predicted 1365
10 SASI_Hs01_00166616 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078412 predicted 281
2 SASI_Hs01_00078413 predicted 273
3 SASI_Hs01_00078414 predicted 1666
4 SASI_Hs01_00078415 predicted 287
5 SASI_Hs01_00078416 predicted 378
6 SASI_Hs01_00078417 predicted 701
7 SASI_Hs01_00078418 predicted 1768
8 SASI_Hs01_00078419 predicted 422
9 SASI_Hs01_00078420 predicted 1491
10 SASI_Hs01_00078421 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288029 predicted 834
2 SASI_Rn02_00288030 predicted 829
3 SASI_Rn02_00288031 predicted 834
4 SASI_Rn02_00288032 predicted 2280
5 SASI_Rn02_00288033 predicted 1065
6 SASI_Rn02_00288034 predicted 1628
7 SASI_Rn02_00288035 predicted 1676
8 SASI_Rn02_00288036 predicted 1669
9 SASI_Rn02_00288037 predicted 1539
10 SASI_Rn02_00288038 predicted 2329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380017 predicted 837
2 SASI_Rn02_00380018 predicted 833
3 SASI_Rn02_00380019 predicted 837
4 SASI_Rn02_00380020 predicted 2279
5 SASI_Rn02_00380021 predicted 1071
6 SASI_Rn02_00380022 predicted 1633
7 SASI_Rn02_00380023 predicted 1687
8 SASI_Rn02_00380024 predicted 1674
9 SASI_Rn02_00380025 predicted 1543
10 SASI_Rn02_00380026 predicted 2339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350032 predicted 1236
2 SASI_Mm02_00350033 predicted 1953
3 SASI_Mm01_00039832 predicted 1601
4 SASI_Mm02_00350034 predicted 1988
5 SASI_Mm01_00039833 predicted 576
6 SASI_Mm01_00039835 predicted 637
7 SASI_Mm01_00039836 predicted 1389
8 SASI_Mm01_00039837 predicted 938
9 SASI_Mm02_00350035 predicted 1546
10 SASI_Mm01_00039839 predicted 541
11 SASI_Mm01_00039831 predicted 498
12 SASI_Mm01_00039834 predicted 1041
13 SASI_Mm01_00039838 predicted 1733
14 SASI_Mm01_00039840 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183029
VALIDATED
IGF2BP2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183029.1-3567s1c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-227s1c1
Sequence:CCGGCCTCTCGGGTAAAGTGGAATTCTCGAGAATTCCACTTTACCCGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-799s1c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-971s1c1
Sequence:CCGGCTTGCAGGATTTGAGCATTTACTCGAGTAAATGCTCAAATCCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-970s1c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1540s21c1
Sequence:CCGGCTGTACCCTCATCACCATTTCCTCGAGGAAATGGTGATGAGGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1250s21c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-2467s21c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-698s21c1
Sequence:CCGGCCGTTGTCAACGTCACCTATACTCGAGTATAGGTGACGTTGACAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1079s21c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183029
VALIDATED
IGF2BP2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183029.1-3567s1c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-227s1c1
Sequence:CCGGCCTCTCGGGTAAAGTGGAATTCTCGAGAATTCCACTTTACCCGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-799s1c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-971s1c1
Sequence:CCGGCTTGCAGGATTTGAGCATTTACTCGAGTAAATGCTCAAATCCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-970s1c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1540s21c1
Sequence:CCGGCTGTACCCTCATCACCATTTCCTCGAGGAAATGGTGATGAGGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1250s21c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-2467s21c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-698s21c1
Sequence:CCGGCCGTTGTCAACGTCACCTATACTCGAGTATAGGTGACGTTGACAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1079s21c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183029
VALIDATED
IGF2BP2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183029.1-3567s1c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-227s1c1
Sequence:CCGGCCTCTCGGGTAAAGTGGAATTCTCGAGAATTCCACTTTACCCGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-799s1c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-971s1c1
Sequence:CCGGCTTGCAGGATTTGAGCATTTACTCGAGTAAATGCTCAAATCCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183029.1-970s1c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1540s21c1
Sequence:CCGGCTGTACCCTCATCACCATTTCCTCGAGGAAATGGTGATGAGGGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1250s21c1
Sequence:CCGGCCTTGCAGGATTTGAGCATTTCTCGAGAAATGCTCAAATCCTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316207    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-2467s21c1
Sequence:CCGGGCCGTTTCTTTGTTGTGGAAACTCGAGTTTCCACAACAAAGAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-698s21c1
Sequence:CCGGCCGTTGTCAACGTCACCTATACTCGAGTATAGGTGACGTTGACAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183029.2-1079s21c1
Sequence:CCGGGCCGCATGATTCTTGAGATTACTCGAGTAATCTCAAGAATCATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006548
VALIDATED
IGF2BP2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1127s1c1
Sequence:CCGGGCTGTTAACCAACAAGCCAATCTCGAGATTGGCTTGTTGGTTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1014s1c1
Sequence:CCGGGCATATACAACCCGGAAAGAACTCGAGTTCTTTCCGGGTTGTATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1675s1c1
Sequence:CCGGCTTAACCAGTGCAGAAGTCATCTCGAGATGACTTCTGCACTGGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1069s1c1
Sequence:CCGGCAGTGCTGAGATAGAGATTATCTCGAGATAATCTCTATCTCAGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1535s1c1
Sequence:CCGGCGGATCTTTGGGAAACTGAAACTCGAGTTTCAGTTTCCCAAAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-440s21c1
Sequence:CCGGGCCGTTGTCAACGTCACATATCTCGAGATATGTGACGTTGACAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-834s21c1
Sequence:CCGGCTGAAGCATGCCGCATGATTCCTCGAGGAATCATGCGGCATGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-640s21c1
Sequence:CCGGTCAGGCCAGACAGATTGATTTCTCGAGAAATCAATCTGTCTGGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-3125s21c1
Sequence:CCGGGTTGGCCCAGGGCGTTAAATTCTCGAGAATTTAACGCCCTGGGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1794s21c1
Sequence:CCGGAGCGCAAGATCAGGGAAATTGCTCGAGCAATTTCCCTGATCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1600s21c1
Sequence:CCGGAGTGAAGCTGGAAGCGCATATCTCGAGATATGCGCTTCCAGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-242s21c1
Sequence:CCGGATCGAGACCCTCTCGGGTAAACTCGAGTTTACCCGAGAGGGTCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1331s21c1
Sequence:CCGGTTCCCGCATCATCACTCTTATCTCGAGATAAGAGTGATGATGCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006548.4-1427s21c1
Sequence:CCGGATCAAACAGCTGGCGAGATTCCTCGAGGAATCTCGCCAGCTGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-2329s21c1
Sequence:CCGGGGTGCCTGCAGCGGTAATATACTCGAGTATATTACCGCTGCAGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006548
VALIDATED
IGF2BP2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1127s1c1
Sequence:CCGGGCTGTTAACCAACAAGCCAATCTCGAGATTGGCTTGTTGGTTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1014s1c1
Sequence:CCGGGCATATACAACCCGGAAAGAACTCGAGTTCTTTCCGGGTTGTATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1675s1c1
Sequence:CCGGCTTAACCAGTGCAGAAGTCATCTCGAGATGACTTCTGCACTGGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1069s1c1
Sequence:CCGGCAGTGCTGAGATAGAGATTATCTCGAGATAATCTCTATCTCAGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1535s1c1
Sequence:CCGGCGGATCTTTGGGAAACTGAAACTCGAGTTTCAGTTTCCCAAAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-440s21c1
Sequence:CCGGGCCGTTGTCAACGTCACATATCTCGAGATATGTGACGTTGACAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-834s21c1
Sequence:CCGGCTGAAGCATGCCGCATGATTCCTCGAGGAATCATGCGGCATGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-640s21c1
Sequence:CCGGTCAGGCCAGACAGATTGATTTCTCGAGAAATCAATCTGTCTGGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-3125s21c1
Sequence:CCGGGTTGGCCCAGGGCGTTAAATTCTCGAGAATTTAACGCCCTGGGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1794s21c1
Sequence:CCGGAGCGCAAGATCAGGGAAATTGCTCGAGCAATTTCCCTGATCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1600s21c1
Sequence:CCGGAGTGAAGCTGGAAGCGCATATCTCGAGATATGCGCTTCCAGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-242s21c1
Sequence:CCGGATCGAGACCCTCTCGGGTAAACTCGAGTTTACCCGAGAGGGTCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1331s21c1
Sequence:CCGGTTCCCGCATCATCACTCTTATCTCGAGATAAGAGTGATGATGCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006548.4-1427s21c1
Sequence:CCGGATCAAACAGCTGGCGAGATTCCTCGAGGAATCTCGCCAGCTGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-2329s21c1
Sequence:CCGGGGTGCCTGCAGCGGTAATATACTCGAGTATATTACCGCTGCAGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006548
VALIDATED
IGF2BP2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1127s1c1
Sequence:CCGGGCTGTTAACCAACAAGCCAATCTCGAGATTGGCTTGTTGGTTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1014s1c1
Sequence:CCGGGCATATACAACCCGGAAAGAACTCGAGTTCTTTCCGGGTTGTATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006548.3-1675s1c1
Sequence:CCGGCTTAACCAGTGCAGAAGTCATCTCGAGATGACTTCTGCACTGGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1069s1c1
Sequence:CCGGCAGTGCTGAGATAGAGATTATCTCGAGATAATCTCTATCTCAGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006548.3-1535s1c1
Sequence:CCGGCGGATCTTTGGGAAACTGAAACTCGAGTTTCAGTTTCCCAAAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-440s21c1
Sequence:CCGGGCCGTTGTCAACGTCACATATCTCGAGATATGTGACGTTGACAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-834s21c1
Sequence:CCGGCTGAAGCATGCCGCATGATTCCTCGAGGAATCATGCGGCATGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-640s21c1
Sequence:CCGGTCAGGCCAGACAGATTGATTTCTCGAGAAATCAATCTGTCTGGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-3125s21c1
Sequence:CCGGGTTGGCCCAGGGCGTTAAATTCTCGAGAATTTAACGCCCTGGGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1794s21c1
Sequence:CCGGAGCGCAAGATCAGGGAAATTGCTCGAGCAATTTCCCTGATCTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1600s21c1
Sequence:CCGGAGTGAAGCTGGAAGCGCATATCTCGAGATATGCGCTTCCAGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-242s21c1
Sequence:CCGGATCGAGACCCTCTCGGGTAAACTCGAGTTTACCCGAGAGGGTCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-1331s21c1
Sequence:CCGGTTCCCGCATCATCACTCTTATCTCGAGATAAGAGTGATGATGCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006548.4-1427s21c1
Sequence:CCGGATCAAACAGCTGGCGAGATTCCTCGAGGAATCTCGCCAGCTGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006548.4-2329s21c1
Sequence:CCGGGGTGCCTGCAGCGGTAATATACTCGAGTATATTACCGCTGCAGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)