EMAIL THIS PAGE TO A FRIEND

IGF2BP3

insulin-like growth factor 2 mRNA binding protein 3

159 Gene Product Result for
Synonyms: CT98 IMP-3 IMP3 KOC1 VICKZ3
UniProtKB ID: O00425, A0A4Z5, Q63HM0, Q6MZZ2, Q86VB1
Gene ID:
Human(10643) Summary: The protein encoded by this gene is primarily found in the nucleolus, where it can bind to the 5' UTR of the insulin-like growth factor II leader 3 mRNA and may repress translation of insulin-like growth factor II during late development. The encoded protein contains several KH domains, which are important in RNA binding and are known to be involved in RNA synthesis and metabolism. A pseudogene exists on chromosome 7, and there are putative pseudogenes on other chromosomes. [provided by RefSeq, Jul 2008]
Mouse(140488) insulin-like growth factor 2 mRNA binding protein 3
Rat(312320) insulin-like growth factor 2 mRNA binding protein 3
Zebrafish(30967) insulin-like growth factor 2 mRNA binding protein 3
chicken(420617) insulin-like growth factor 2 mRNA binding protein 3
dog(482357) insulin-like growth factor 2 mRNA binding protein 3
domestic cat(101090427) insulin-like growth factor 2 mRNA binding protein 3
cow(539650) insulin-like growth factor 2 mRNA binding protein 3
domestic guinea pig(100735179) insulin-like growth factor 2 mRNA binding protein 3
naked mole-rat(101726090) insulin-like growth factor 2 mRNA binding protein 3
sheep(101110498) insulin-like growth factor 2 mRNA binding protein 3
Domestic Rabbit(100351075) insulin-like growth factor 2 mRNA binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006547 Rosetta Predictions human pricing
NM_001047888 Rosetta Predictions rat pricing
NM_023670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207964 predicted 625
2 SASI_Hs01_00207965 predicted 1053
3 SASI_Hs01_00207966 predicted 1202
4 SASI_Hs02_00341810 predicted 1720
5 SASI_Hs02_00341811 predicted 1195
6 SASI_Hs01_00207967 predicted 1618
7 SASI_Hs01_00207968 predicted 551
8 SASI_Hs01_00207969 predicted 836
9 SASI_Hs01_00207970 predicted 1032
10 SASI_Hs01_00207971 predicted 873
11 SASI_Hs01_00207963 predicted 1491
12 SASI_Hs01_00207972 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206517 predicted 244
2 SASI_Rn02_00206518 predicted 210
3 SASI_Rn02_00206519 predicted 224
4 SASI_Rn02_00206520 predicted 263
5 SASI_Rn02_00206521 predicted 247
6 SASI_Rn02_00206522 predicted 201
7 SASI_Rn02_00206523 predicted 196
8 SASI_Rn02_00206524 predicted 212
9 SASI_Rn02_00206525 predicted 315
10 SASI_Rn02_00206526 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076471 predicted 1900
2 SASI_Mm01_00076472 predicted 598
3 SASI_Mm01_00076473 predicted 1315
4 SASI_Mm01_00076474 predicted 1032
5 SASI_Mm01_00076475 predicted 1766
6 SASI_Mm01_00076476 predicted 481
7 SASI_Mm01_00076477 predicted 524
8 SASI_Mm01_00076478 predicted 905
9 SASI_Mm02_00327290 predicted 706
10 SASI_Mm01_00076479 predicted 851
11 SASI_Mm01_00076480 predicted 1223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023670
IGF2BP3 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-2204s21c1
Sequence:CCGGCTCAGTCAAGGCGGAAGTAAACTCGAGTTTACTTCCGCCTTGACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1445s21c1
Sequence:CCGGACAATCCGGAACGCACCATTACTCGAGTAATGGTGCGTTCCGGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1783s21c1
Sequence:CCGGTTTGCGGGAGCTTCGATTAAGCTCGAGCTTAATCGAAGCTCCCGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023670.2-2283s1c1
Sequence:CCGGCCCTCTATAATGCCAGAAATTCTCGAGAATTTCTGGCATTATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-1429s1c1
Sequence:CCGGCCTACCCACAATTTGAGCAATCTCGAGATTGCTCAAATTGTGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-646s1c1
Sequence:CCGGCCTTAGACAAACTGAATGGATCTCGAGATCCATTCAGTTTGTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-471s1c1
Sequence:CCGGCGGCAGAGGATTCGTAAACTTCTCGAGAAGTTTACGAATCCTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-959s1c1
Sequence:CCGGCGCGGAGAAGTCCATTACTATCTCGAGATAGTAATGGACTTCTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023670
IGF2BP3 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-2204s21c1
Sequence:CCGGCTCAGTCAAGGCGGAAGTAAACTCGAGTTTACTTCCGCCTTGACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1445s21c1
Sequence:CCGGACAATCCGGAACGCACCATTACTCGAGTAATGGTGCGTTCCGGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1783s21c1
Sequence:CCGGTTTGCGGGAGCTTCGATTAAGCTCGAGCTTAATCGAAGCTCCCGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023670.2-2283s1c1
Sequence:CCGGCCCTCTATAATGCCAGAAATTCTCGAGAATTTCTGGCATTATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-1429s1c1
Sequence:CCGGCCTACCCACAATTTGAGCAATCTCGAGATTGCTCAAATTGTGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-646s1c1
Sequence:CCGGCCTTAGACAAACTGAATGGATCTCGAGATCCATTCAGTTTGTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-471s1c1
Sequence:CCGGCGGCAGAGGATTCGTAAACTTCTCGAGAAGTTTACGAATCCTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-959s1c1
Sequence:CCGGCGCGGAGAAGTCCATTACTATCTCGAGATAGTAATGGACTTCTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023670
IGF2BP3 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-2204s21c1
Sequence:CCGGCTCAGTCAAGGCGGAAGTAAACTCGAGTTTACTTCCGCCTTGACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1445s21c1
Sequence:CCGGACAATCCGGAACGCACCATTACTCGAGTAATGGTGCGTTCCGGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023670.3-1783s21c1
Sequence:CCGGTTTGCGGGAGCTTCGATTAAGCTCGAGCTTAATCGAAGCTCCCGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023670.2-2283s1c1
Sequence:CCGGCCCTCTATAATGCCAGAAATTCTCGAGAATTTCTGGCATTATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-1429s1c1
Sequence:CCGGCCTACCCACAATTTGAGCAATCTCGAGATTGCTCAAATTGTGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-646s1c1
Sequence:CCGGCCTTAGACAAACTGAATGGATCTCGAGATCCATTCAGTTTGTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-471s1c1
Sequence:CCGGCGGCAGAGGATTCGTAAACTTCTCGAGAAGTTTACGAATCCTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023670.2-959s1c1
Sequence:CCGGCGCGGAGAAGTCCATTACTATCTCGAGATAGTAATGGACTTCTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006547
VALIDATED
IGF2BP3 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 mRNA binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1211s21c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1792s21c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-509s21c1
Sequence:CCGGGAAACTTCAGATACGAAATATCTCGAGATATTTCGTATCTGAAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-2284s21c1
Sequence:CCGGTGTTGTAGTCTCACAGTATAACTCGAGTTATACTGTGAGACTACAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1026s21c1
Sequence:CCGGTCTGCGGCTTGTAAGTCTATTCTCGAGAATAGACTTACAAGCCGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-3584s1c1
Sequence:CCGGGCCTCATTCTTATTTCAAGATCTCGAGATCTTGAAATAAGAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1792s1c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1211s1c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-624s1c1
Sequence:CCGGGCAGTTGTAAATGTAACCTATCTCGAGATAGGTTACATTTACAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006547.2-1350s1c1
Sequence:CCGGGCACATTTAATTCCTGGATTACTCGAGTAATCCAGGAATTAAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006547
VALIDATED
IGF2BP3 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 mRNA binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1211s21c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1792s21c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-509s21c1
Sequence:CCGGGAAACTTCAGATACGAAATATCTCGAGATATTTCGTATCTGAAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-2284s21c1
Sequence:CCGGTGTTGTAGTCTCACAGTATAACTCGAGTTATACTGTGAGACTACAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1026s21c1
Sequence:CCGGTCTGCGGCTTGTAAGTCTATTCTCGAGAATAGACTTACAAGCCGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-3584s1c1
Sequence:CCGGGCCTCATTCTTATTTCAAGATCTCGAGATCTTGAAATAAGAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1792s1c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1211s1c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-624s1c1
Sequence:CCGGGCAGTTGTAAATGTAACCTATCTCGAGATAGGTTACATTTACAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006547.2-1350s1c1
Sequence:CCGGGCACATTTAATTCCTGGATTACTCGAGTAATCCAGGAATTAAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006547
VALIDATED
IGF2BP3 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 mRNA binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1211s21c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1792s21c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-509s21c1
Sequence:CCGGGAAACTTCAGATACGAAATATCTCGAGATATTTCGTATCTGAAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-2284s21c1
Sequence:CCGGTGTTGTAGTCTCACAGTATAACTCGAGTTATACTGTGAGACTACAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006547.2-1026s21c1
Sequence:CCGGTCTGCGGCTTGTAAGTCTATTCTCGAGAATAGACTTACAAGCCGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-3584s1c1
Sequence:CCGGGCCTCATTCTTATTTCAAGATCTCGAGATCTTGAAATAAGAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1792s1c1
Sequence:CCGGCGGTGAATGAACTTCAGAATTCTCGAGAATTCTGAAGTTCATTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-1211s1c1
Sequence:CCGGGCAGGAATTGACGCTGTATAACTCGAGTTATACAGCGTCAATTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006547.2-624s1c1
Sequence:CCGGGCAGTTGTAAATGTAACCTATCTCGAGATAGGTTACATTTACAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006547.2-1350s1c1
Sequence:CCGGGCACATTTAATTCCTGGATTACTCGAGTAATCCAGGAATTAAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)