EMAIL THIS PAGE TO A FRIEND

IGF2R

insulin-like growth factor 2 receptor

75 Gene Product Result for
Synonyms: CD222 CIMPR M6P-R MPR1 MPRI
UniProtKB ID: P11717, Q7Z7G9, Q96PT5
Gene ID:
Human(3482) Summary: This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate, although the binding sites for either are located on different segments of the receptor. This receptor functions in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. While the related mouse gene shows exclusive expression from the maternal allele, imprinting of the human gene appears to be polymorphic, with only a minority of individuals showing expression from the maternal allele. [provided by RefSeq, Apr 2013]
Mouse(16004) insulin-like growth factor 2 receptor
Rat(25151) insulin-like growth factor 2 receptor
Goat(100860744) insulin-like growth factor 2 receptor
domestic guinea pig(100725901) insulin-like growth factor 2 receptor
naked mole-rat(101707470) insulin-like growth factor 2 receptor
Zebrafish(557061) insulin-like growth factor 2 receptor
domestic cat(100500935) insulin-like growth factor 2 receptor
Horse(100058539) insulin-like growth factor 2 receptor
cow(281849) insulin-like growth factor 2 receptor
dog(484067) insulin-like growth factor 2 receptor
chicken(395817) insulin-like growth factor 2 receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA011332 Anti-IGF2R antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501525 Anti-IGF2R, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4501526 Anti-IGF2R, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504307 Anti-phospho-IGF2R (pSer2409) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301274 Anti-phospho-IGF2R (pSer2409) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4504234 Anti-phospho-IGF2R (pSer2484) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4700341 Monoclonal Anti-CD222 antibody produced in mouse clone MEM-238, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700342 Monoclonal Anti-CD222-APC antibody produced in mouse clone MEM-238, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700343 Monoclonal Anti-CD222-FITC antibody produced in mouse clone MEM-238, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry pricing
SAB4700697 Monoclonal Anti-CD222-PE antibody produced in mouse clone MEM-238, purified immunoglobulin, buffered aqueous solution human, nonhuman primates
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000876 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000876 siRNAs that have been validated in the lab human pricing
NM_012756 Rosetta Predictions rat pricing
NM_010515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000876 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180853 validated 2389
1 SASI_Hs01_00180852 validated 3447
1 SASI_Hs01_00180854 validated 3641
2 SASI_Hs02_00303411 predicted 5008
3 SASI_Hs01_00180856 predicted 5971
4 SASI_Hs01_00180857 predicted 1528
5 SASI_Hs01_00180858 predicted 5106
6 SASI_Hs01_00180859 predicted 3516
7 SASI_Hs01_00180860 predicted 5191
8 SASI_Hs02_00303412 predicted 1505
9 SASI_Hs02_00303413 predicted 2212
10 SASI_Hs01_00180855 predicted 1069
11 SASI_Hs01_00180861 predicted 6453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057412 predicted 5007
2 SASI_Rn01_00057413 predicted 379
3 SASI_Rn02_00260117 predicted 1730
4 SASI_Rn01_00057414 predicted 2293
5 SASI_Rn02_00260118 predicted 3923
6 SASI_Rn01_00057415 predicted 1788
7 SASI_Rn01_00057417 predicted 4080
8 SASI_Rn02_00260119 predicted 2586
9 SASI_Rn01_00057419 predicted 5816
10 SASI_Rn02_00260120 predicted 5796
11 SASI_Rn01_00057410 predicted 2125
12 SASI_Rn01_00057411 predicted 5488
13 SASI_Rn01_00057416 predicted 2144
14 SASI_Rn01_00057418 predicted 5023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318786 predicted 2691
2 SASI_Mm01_00194975 predicted 3734
3 SASI_Mm01_00194976 predicted 3609
4 SASI_Mm01_00194977 predicted 2390
5 SASI_Mm01_00194978 predicted 1520
6 SASI_Mm01_00194979 predicted 7106
7 SASI_Mm01_00194980 predicted 5910
8 SASI_Mm01_00194981 predicted 6365
9 SASI_Mm01_00194982 predicted 1765
10 SASI_Mm01_00194983 predicted 5484
11 SASI_Mm01_00194984 predicted 5127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010515
VALIDATED
IGF2R MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010515.1-8497s1c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010515.1-2524s1c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-5962s1c1
Sequence:CCGGGCGATCATATTTACGTGTGATCTCGAGATCACACGTAAATATGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-2422s1c1
Sequence:CCGGCCCTCCATGATGGAACAGTATCTCGAGATACTGTTCCATCATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-592s1c1
Sequence:CCGGGCCTGCAAGAAAGACATATTTCTCGAGAAATATGTCTTTCTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-5114s21c1
Sequence:CCGGGCGGAATGGAAGCTCGATTATCTCGAGATAATCGAGCTTCCATTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-2568s21c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-8542s21c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-4124s21c1
Sequence:CCGGGCGCTCCACAACCATCTATTTCTCGAGAAATAGATGGTTGTGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-1180s21c1
Sequence:CCGGTTAGTCCCTTGGCCCAATATGCTCGAGCATATTGGGCCAAGGGACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010515
VALIDATED
IGF2R MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010515.1-8497s1c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010515.1-2524s1c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-5962s1c1
Sequence:CCGGGCGATCATATTTACGTGTGATCTCGAGATCACACGTAAATATGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-2422s1c1
Sequence:CCGGCCCTCCATGATGGAACAGTATCTCGAGATACTGTTCCATCATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-592s1c1
Sequence:CCGGGCCTGCAAGAAAGACATATTTCTCGAGAAATATGTCTTTCTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-5114s21c1
Sequence:CCGGGCGGAATGGAAGCTCGATTATCTCGAGATAATCGAGCTTCCATTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-2568s21c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-8542s21c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-4124s21c1
Sequence:CCGGGCGCTCCACAACCATCTATTTCTCGAGAAATAGATGGTTGTGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-1180s21c1
Sequence:CCGGTTAGTCCCTTGGCCCAATATGCTCGAGCATATTGGGCCAAGGGACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010515
VALIDATED
IGF2R MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010515.1-8497s1c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010515.1-2524s1c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-5962s1c1
Sequence:CCGGGCGATCATATTTACGTGTGATCTCGAGATCACACGTAAATATGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-2422s1c1
Sequence:CCGGCCCTCCATGATGGAACAGTATCTCGAGATACTGTTCCATCATGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010515.1-592s1c1
Sequence:CCGGGCCTGCAAGAAAGACATATTTCTCGAGAAATATGTCTTTCTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-5114s21c1
Sequence:CCGGGCGGAATGGAAGCTCGATTATCTCGAGATAATCGAGCTTCCATTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-2568s21c1
Sequence:CCGGCGGAGGAAATACTACCTCAATCTCGAGATTGAGGTAGTATTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287512    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-8542s21c1
Sequence:CCGGCGACCTATAAGAAGCCTTAATCTCGAGATTAAGGCTTCTTATAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-4124s21c1
Sequence:CCGGGCGCTCCACAACCATCTATTTCTCGAGAAATAGATGGTTGTGGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010515.2-1180s21c1
Sequence:CCGGTTAGTCCCTTGGCCCAATATGCTCGAGCATATTGGGCCAAGGGACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000876
VALIDATED
IGF2R MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-1067s1c1
Sequence:CCGGGCTATGAAATTGAGTGGATTACTCGAGTAATCCACTCAATTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-6454s1c1
Sequence:CCGGCCTGCATTCAAGAGGTTTGATCTCGAGATCAAACCTCTTGAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-3900s1c1
Sequence:CCGGCGCTGGCGAATACACTTATTACTCGAGTAATAAGTGTATTCGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-5991s1c1
Sequence:CCGGCCGGACATCCAGCATCATATTCTCGAGAATATGATGCTGGATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-626s1c1
Sequence:CCGGCCTGCAAGAAAGACATATTTACTCGAGTAAATATGTCTTTCTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-5886s21c1
Sequence:CCGGGCTACGAGGAGTGCATCATAGCTCGAGCTATGATGCACTCCTCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-1187s21c1
Sequence:CCGGAGCGGAGGTTCATCCTATATTCTCGAGAATATAGGATGAACCTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000876.2-7666s21c1
Sequence:CCGGCAAGCACCTCCAACCAAATAACTCGAGTTATTTGGTTGGAGGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-4510s21c1
Sequence:CCGGATACGTTGATGGCGACTTATGCTCGAGCATAAGTCGCCATCAACGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000876
VALIDATED
IGF2R MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-1067s1c1
Sequence:CCGGGCTATGAAATTGAGTGGATTACTCGAGTAATCCACTCAATTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-6454s1c1
Sequence:CCGGCCTGCATTCAAGAGGTTTGATCTCGAGATCAAACCTCTTGAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-3900s1c1
Sequence:CCGGCGCTGGCGAATACACTTATTACTCGAGTAATAAGTGTATTCGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-5991s1c1
Sequence:CCGGCCGGACATCCAGCATCATATTCTCGAGAATATGATGCTGGATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-626s1c1
Sequence:CCGGCCTGCAAGAAAGACATATTTACTCGAGTAAATATGTCTTTCTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-5886s21c1
Sequence:CCGGGCTACGAGGAGTGCATCATAGCTCGAGCTATGATGCACTCCTCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-1187s21c1
Sequence:CCGGAGCGGAGGTTCATCCTATATTCTCGAGAATATAGGATGAACCTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000876.2-7666s21c1
Sequence:CCGGCAAGCACCTCCAACCAAATAACTCGAGTTATTTGGTTGGAGGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-4510s21c1
Sequence:CCGGATACGTTGATGGCGACTTATGCTCGAGCATAAGTCGCCATCAACGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000876
VALIDATED
IGF2R MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-1067s1c1
Sequence:CCGGGCTATGAAATTGAGTGGATTACTCGAGTAATCCACTCAATTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-6454s1c1
Sequence:CCGGCCTGCATTCAAGAGGTTTGATCTCGAGATCAAACCTCTTGAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_000876.1-3900s1c1
Sequence:CCGGCGCTGGCGAATACACTTATTACTCGAGTAATAAGTGTATTCGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-5991s1c1
Sequence:CCGGCCGGACATCCAGCATCATATTCTCGAGAATATGATGCTGGATGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000876.1-626s1c1
Sequence:CCGGCCTGCAAGAAAGACATATTTACTCGAGTAAATATGTCTTTCTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-5886s21c1
Sequence:CCGGGCTACGAGGAGTGCATCATAGCTCGAGCTATGATGCACTCCTCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-1187s21c1
Sequence:CCGGAGCGGAGGTTCATCCTATATTCTCGAGAATATAGGATGAACCTCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000876.2-7666s21c1
Sequence:CCGGCAAGCACCTCCAACCAAATAACTCGAGTTATTTGGTTGGAGGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000876.2-4510s21c1
Sequence:CCGGATACGTTGATGGCGACTTATGCTCGAGCATAAGTCGCCATCAACGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)