EMAIL THIS PAGE TO A FRIEND

IGFALS

insulin-like growth factor binding protein, acid labile subunit

43 Gene Product Result for
Synonyms: ALS
UniProtKB ID: P35858, B4DZY8, E9PGU3
Gene ID:
Human(3483) Summary: The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(16005) insulin-like growth factor binding protein, acid labile subunit
Rat(79438) insulin-like growth factor binding protein, acid labile subunit
chicken(427649) insulin-like growth factor binding protein, acid labile subunit
dog(490069) insulin-like growth factor binding protein, acid labile subunit
cow(532494) insulin-like growth factor binding protein, acid labile subunit
domestic cat(101085518) insulin-like growth factor binding protein, acid labile subunit
domestic guinea pig(100728190) insulin-like growth factor binding protein, acid labile subunit
naked mole-rat(101726656) insulin-like growth factor binding protein, acid labile subunit
sheep(101111599) insulin-like growth factor binding protein, acid labile subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0515 AQUA Peptide ANVFVQLP[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155991 MISSION® esiRNA esiRNA human IGFALS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004970 Rosetta Predictions human pricing
NM_053329 Rosetta Predictions rat pricing
NM_008340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338673 predicted 1143
2 SASI_Hs01_00162756 predicted 1662
3 SASI_Hs01_00162757 predicted 741
4 SASI_Hs01_00162759 predicted 1068
5 SASI_Hs01_00162760 predicted 1680
6 SASI_Hs01_00162761 predicted 571
7 SASI_Hs01_00162762 predicted 213
8 SASI_Hs01_00162764 predicted 1132
9 SASI_Hs02_00338674 predicted 1077
10 SASI_Hs01_00162765 predicted 927
11 SASI_Hs01_00162758 predicted 1156
12 SASI_Hs01_00162763 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265764 predicted 253
2 SASI_Rn02_00265765 predicted 342
3 SASI_Rn02_00265766 predicted 1813
4 SASI_Rn02_00265767 predicted 1877
5 SASI_Rn02_00265768 predicted 1237
6 SASI_Rn02_00265769 predicted 1864
7 SASI_Rn02_00265770 predicted 1870
8 SASI_Rn02_00265771 predicted 795
9 SASI_Rn02_00265772 predicted 1195
10 SASI_Rn02_00265773 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139027 predicted 730
2 SASI_Mm01_00139028 predicted 1884
3 SASI_Mm01_00139029 predicted 1054
4 SASI_Mm01_00139030 predicted 1071
5 SASI_Mm01_00139031 predicted 1575
6 SASI_Mm01_00139032 predicted 1817
7 SASI_Mm01_00139033 predicted 239
8 SASI_Mm02_00313675 predicted 284
9 SASI_Mm01_00139034 predicted 1130
10 SASI_Mm01_00139035 predicted 1445
11 SASI_Mm01_00139036 predicted 1010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004970
IGFALS MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein, acid labile subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1600s21c1
Sequence:CCGGACAACTCACTGCGGACCTTCACTCGAGTGAAGGTCCGCAGTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1777s21c1
Sequence:CCGGCCGCGTACACCTACAACAACACTCGAGTGTTGTTGTAGGTGTACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-749s21c1
Sequence:CCGGGGCCATCAAGGCAAACGTGTTCTCGAGAACACGTTTGCCTTGATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-577s21c1
Sequence:CCGGACCTCAACCTCGGCTGGAATACTCGAGTATTCCAGCCGAGGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-188s21c1
Sequence:CCGGCTGTGTCTGCAGCTACGATGACTCGAGTCATCGTAGCTGCAGACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004970
IGFALS MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein, acid labile subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1600s21c1
Sequence:CCGGACAACTCACTGCGGACCTTCACTCGAGTGAAGGTCCGCAGTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1777s21c1
Sequence:CCGGCCGCGTACACCTACAACAACACTCGAGTGTTGTTGTAGGTGTACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-749s21c1
Sequence:CCGGGGCCATCAAGGCAAACGTGTTCTCGAGAACACGTTTGCCTTGATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-577s21c1
Sequence:CCGGACCTCAACCTCGGCTGGAATACTCGAGTATTCCAGCCGAGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-188s21c1
Sequence:CCGGCTGTGTCTGCAGCTACGATGACTCGAGTCATCGTAGCTGCAGACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004970
IGFALS MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein, acid labile subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1600s21c1
Sequence:CCGGACAACTCACTGCGGACCTTCACTCGAGTGAAGGTCCGCAGTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-1777s21c1
Sequence:CCGGCCGCGTACACCTACAACAACACTCGAGTGTTGTTGTAGGTGTACGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-749s21c1
Sequence:CCGGGGCCATCAAGGCAAACGTGTTCTCGAGAACACGTTTGCCTTGATGGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-577s21c1
Sequence:CCGGACCTCAACCTCGGCTGGAATACTCGAGTATTCCAGCCGAGGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004970.1-188s21c1
Sequence:CCGGCTGTGTCTGCAGCTACGATGACTCGAGTCATCGTAGCTGCAGACACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008340
IGFALS MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein, acid labile subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000109598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-1007s1c1
Sequence:CCGGCCACAATCGTATCAGGCAGTTCTCGAGAACTGCCTGATACGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008340.2-1898s1c1
Sequence:CCGGCCAGGATAGTGTTTCACTGTTCTCGAGAACAGTGAAACACTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-736s1c1
Sequence:CCGGGCGTCAAAGCTAATGTCTTTACTCGAGTAAAGACATTAGCTTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-460s1c1
Sequence:CCGGGCTTGTTCAGACACACACCAACTCGAGTTGGTGTGTGTCTGAACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008340
IGFALS MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein, acid labile subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000109598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-1007s1c1
Sequence:CCGGCCACAATCGTATCAGGCAGTTCTCGAGAACTGCCTGATACGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008340.2-1898s1c1
Sequence:CCGGCCAGGATAGTGTTTCACTGTTCTCGAGAACAGTGAAACACTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-736s1c1
Sequence:CCGGGCGTCAAAGCTAATGTCTTTACTCGAGTAAAGACATTAGCTTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-460s1c1
Sequence:CCGGGCTTGTTCAGACACACACCAACTCGAGTTGGTGTGTGTCTGAACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008340
IGFALS MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein, acid labile subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000109598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-1007s1c1
Sequence:CCGGCCACAATCGTATCAGGCAGTTCTCGAGAACTGCCTGATACGATTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008340.2-1898s1c1
Sequence:CCGGCCAGGATAGTGTTTCACTGTTCTCGAGAACAGTGAAACACTATCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-736s1c1
Sequence:CCGGGCGTCAAAGCTAATGTCTTTACTCGAGTAAAGACATTAGCTTTGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008340.2-460s1c1
Sequence:CCGGGCTTGTTCAGACACACACCAACTCGAGTTGGTGTGTGTCTGAACAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)