EMAIL THIS PAGE TO A FRIEND

IGFBP1

insulin-like growth factor binding protein 1

79 Gene Product Result for
Synonyms: AFBP IBP1 IGF-BP25 PP12 hIGFBP-1
UniProtKB ID: P08833, A4D2F4, D3DVL9, Q8IYP5
Gene ID:
Human(3484) Summary: This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]
Mouse(16006) insulin-like growth factor binding protein 1
Rat(25685) insulin-like growth factor binding protein 1
chicken(408027) insulin-like growth factor binding protein 1
dog(480812) insulin-like growth factor binding protein 1
domestic cat(101101629) insulin-like growth factor binding protein 1
cow(282259) insulin-like growth factor binding protein 1
Goat(100860913) insulin-like growth factor binding protein 1
sheep(443132) insulin-like growth factor binding protein 1
Domestic Rabbit(100125997) insulin-like growth factor binding protein 1
domestic guinea pig(100715392) insulin-like growth factor binding protein 1
naked mole-rat(101708601) insulin-like growth factor binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S8442 SU 5416 ≥98% (HPLC) human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000596 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131401 MISSION® esiRNA esiRNA human IGFBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000596 Rosetta Predictions human pricing
NM_001013029 Rosetta Predictions human pricing
NM_013144 Rosetta Predictions rat pricing
NM_008341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302868 predicted 803
2 SASI_Hs02_00302869 predicted 744
3 SASI_Hs02_00302870 predicted 833
4 SASI_Hs02_00302871 predicted 860
5 SASI_Hs02_00302872 predicted 660
6 SASI_Hs02_00302873 predicted 832
7 SASI_Hs02_00302874 predicted 815
8 SASI_Hs02_00302875 predicted 658
9 SASI_Hs02_00302876 predicted 872
10 SASI_Hs02_00302877 predicted 832
11 SASI_Hs01_00117398 predicted 463
12 SASI_Hs01_00117399 predicted 452
13 SASI_Hs01_00117400 predicted 317
14 SASI_Hs01_00117401 predicted 388
15 SASI_Hs01_00117402 predicted 388
16 SASI_Hs01_00117403 predicted 421
17 SASI_Hs01_00117404 predicted 580
18 SASI_Hs01_00117405 predicted 380
19 SASI_Hs01_00117406 predicted 338
20 SASI_Hs01_00117407 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176440 predicted 454
2 SASI_Hs01_00176441 predicted 446
3 SASI_Hs01_00176442 predicted 320
4 SASI_Hs01_00176443 predicted 388
5 SASI_Hs01_00176444 predicted 385
6 SASI_Hs01_00176445 predicted 420
7 SASI_Hs01_00176446 predicted 580
8 SASI_Hs01_00176447 predicted 382
9 SASI_Hs01_00176448 predicted 340
10 SASI_Hs01_00176449 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116564 predicted 1117
2 SASI_Rn01_00116565 predicted 1157
3 SASI_Rn01_00116566 predicted 1112
4 SASI_Rn01_00116567 predicted 1162
5 SASI_Rn01_00116568 predicted 501
6 SASI_Rn01_00116569 predicted 1164
7 SASI_Rn01_00116570 predicted 1222
8 SASI_Rn01_00116571 predicted 731
9 SASI_Rn02_00260942 predicted 685
10 SASI_Rn01_00116572 predicted 843
11 SASI_Rn01_00116573 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313676 predicted 885
2 SASI_Mm01_00093230 predicted 663
3 SASI_Mm02_00313677 predicted 1217
4 SASI_Mm02_00313678 predicted 1270
5 SASI_Mm01_00093233 predicted 1107
6 SASI_Mm01_00093234 predicted 744
7 SASI_Mm01_00093235 predicted 978
8 SASI_Mm01_00093236 predicted 1105
9 SASI_Mm01_00093237 predicted 530
10 SASI_Mm02_00313679 predicted 1282
11 SASI_Mm01_00093228 predicted 1213
12 SASI_Mm01_00093229 predicted 211
13 SASI_Mm01_00093231 predicted 213
14 SASI_Mm01_00093232 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008341
VALIDATED
IGFBP1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-774s1c1
Sequence:CCGGCGAGAACTCTATAAAGTGCTACTCGAGTAGCACTTTATAGAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-740s1c1
Sequence:CCGGCGCCGACCTCAAGAAATGGAACTCGAGTTCCATTTCTTGAGGTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-880s1c1
Sequence:CCGGACAGCAAACAGTGTGAGACATCTCGAGATGTCTCACACTGTTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-848s1c1
Sequence:CCGGTCTGCCAAACTGCAACAAGAACTCGAGTTCTTGTTGCAGTTTGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-1154s1c1
Sequence:CCGGGCTTGATACATGAAGCTGGTTCTCGAGAACCAGCTTCATGTATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008341.4-1219s21c1
Sequence:CCGGTCTCATCTCTGTACATGTAAACTCGAGTTTACATGTACAGAGATGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-526s21c1
Sequence:CCGGGTTCAGCTCCCAGCATGAAGACTCGAGTCTTCATGCTGGGAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-667s21c1
Sequence:CCGGGAACGCCATCAGCACCTATAGCTCGAGCTATAGGTGCTGATGGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008341
VALIDATED
IGFBP1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-774s1c1
Sequence:CCGGCGAGAACTCTATAAAGTGCTACTCGAGTAGCACTTTATAGAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-740s1c1
Sequence:CCGGCGCCGACCTCAAGAAATGGAACTCGAGTTCCATTTCTTGAGGTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-880s1c1
Sequence:CCGGACAGCAAACAGTGTGAGACATCTCGAGATGTCTCACACTGTTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-848s1c1
Sequence:CCGGTCTGCCAAACTGCAACAAGAACTCGAGTTCTTGTTGCAGTTTGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-1154s1c1
Sequence:CCGGGCTTGATACATGAAGCTGGTTCTCGAGAACCAGCTTCATGTATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008341.4-1219s21c1
Sequence:CCGGTCTCATCTCTGTACATGTAAACTCGAGTTTACATGTACAGAGATGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-526s21c1
Sequence:CCGGGTTCAGCTCCCAGCATGAAGACTCGAGTCTTCATGCTGGGAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-667s21c1
Sequence:CCGGGAACGCCATCAGCACCTATAGCTCGAGCTATAGGTGCTGATGGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008341
VALIDATED
IGFBP1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-774s1c1
Sequence:CCGGCGAGAACTCTATAAAGTGCTACTCGAGTAGCACTTTATAGAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-740s1c1
Sequence:CCGGCGCCGACCTCAAGAAATGGAACTCGAGTTCCATTTCTTGAGGTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-880s1c1
Sequence:CCGGACAGCAAACAGTGTGAGACATCTCGAGATGTCTCACACTGTTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008341.2-848s1c1
Sequence:CCGGTCTGCCAAACTGCAACAAGAACTCGAGTTCTTGTTGCAGTTTGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008341.2-1154s1c1
Sequence:CCGGGCTTGATACATGAAGCTGGTTCTCGAGAACCAGCTTCATGTATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008341.4-1219s21c1
Sequence:CCGGTCTCATCTCTGTACATGTAAACTCGAGTTTACATGTACAGAGATGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-526s21c1
Sequence:CCGGGTTCAGCTCCCAGCATGAAGACTCGAGTCTTCATGCTGGGAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008341.4-667s21c1
Sequence:CCGGGAACGCCATCAGCACCTATAGCTCGAGCTATAGGTGCTGATGGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000596
VALIDATED
IGFBP1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1479s1c1
Sequence:CCGGCCACCATTCACATTTGATGTACTCGAGTACATCAAATGTGAATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-598s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-746s1c1
Sequence:CCGGCAGGAGAAGAAATTTCCAAATCTCGAGATTTGGAAATTTCTTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-687s1c1
Sequence:CCGGGCCCTGCCGAATAGAACTCTACTCGAGTAGAGTTCTATTCGGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-630s1c1
Sequence:CCGGCAGTACCTATGATGGCTCGAACTCGAGTTCGAGCCATCATAGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1457s1c1
Sequence:CCGGGAGGACGGTTAACTTGTATATCTCGAGATATACAAGTTAACCGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-695s1c1
Sequence:CCGGCCTGGATAATTTCCATCTGATCTCGAGATCAGATGGAAATTATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-833s1c1
Sequence:CCGGCTACAGAGTCGTAGAGAGTTTCTCGAGAAACTCTCTACGACTCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-726s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-903s1c1
Sequence:CCGGCCAAACTGCAACAAGAATGGACTCGAGTCCATTCTTGTTGCAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000596
VALIDATED
IGFBP1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1479s1c1
Sequence:CCGGCCACCATTCACATTTGATGTACTCGAGTACATCAAATGTGAATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-598s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-746s1c1
Sequence:CCGGCAGGAGAAGAAATTTCCAAATCTCGAGATTTGGAAATTTCTTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-687s1c1
Sequence:CCGGGCCCTGCCGAATAGAACTCTACTCGAGTAGAGTTCTATTCGGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-630s1c1
Sequence:CCGGCAGTACCTATGATGGCTCGAACTCGAGTTCGAGCCATCATAGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1457s1c1
Sequence:CCGGGAGGACGGTTAACTTGTATATCTCGAGATATACAAGTTAACCGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-695s1c1
Sequence:CCGGCCTGGATAATTTCCATCTGATCTCGAGATCAGATGGAAATTATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-833s1c1
Sequence:CCGGCTACAGAGTCGTAGAGAGTTTCTCGAGAAACTCTCTACGACTCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-726s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-903s1c1
Sequence:CCGGCCAAACTGCAACAAGAATGGACTCGAGTCCATTCTTGTTGCAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000596
VALIDATED
IGFBP1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1479s1c1
Sequence:CCGGCCACCATTCACATTTGATGTACTCGAGTACATCAAATGTGAATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-598s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.1-746s1c1
Sequence:CCGGCAGGAGAAGAAATTTCCAAATCTCGAGATTTGGAAATTTCTTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-687s1c1
Sequence:CCGGGCCCTGCCGAATAGAACTCTACTCGAGTAGAGTTCTATTCGGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.1-630s1c1
Sequence:CCGGCAGTACCTATGATGGCTCGAACTCGAGTTCGAGCCATCATAGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-1457s1c1
Sequence:CCGGGAGGACGGTTAACTTGTATATCTCGAGATATACAAGTTAACCGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-695s1c1
Sequence:CCGGCCTGGATAATTTCCATCTGATCTCGAGATCAGATGGAAATTATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-833s1c1
Sequence:CCGGCTACAGAGTCGTAGAGAGTTTCTCGAGAAACTCTCTACGACTCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000596.2-726s1c1
Sequence:CCGGGAAGAGGATCATTCCATCCTTCTCGAGAAGGATGGAATGATCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000596.2-903s1c1
Sequence:CCGGCCAAACTGCAACAAGAATGGACTCGAGTCCATTCTTGTTGCAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)