EMAIL THIS PAGE TO A FRIEND

IGFBP2

insulin-like growth factor binding protein 2, 36kDa

111 Gene Product Result for
Synonyms: IBP2 IGF-BP53
UniProtKB ID: P18065, Q14619, Q9UCL3
Gene ID:
Mouse(16008) insulin-like growth factor binding protein 2
Rat(25662) insulin-like growth factor binding protein 2
chicken(396315) insulin-like growth factor binding protein 2, 36kDa
domestic cat(101088426) insulin-like growth factor binding protein 2, 36kDa
cow(282260) insulin-like growth factor binding protein 2, 36kDa
Horse(100034061) insulin-like growth factor binding protein 2, 36kDa
dog(488516) insulin-like growth factor binding protein 2, 36kDa
domestic guinea pig(100727726) insulin-like growth factor binding protein 2, 36kDa
naked mole-rat(101717162) insulin-like growth factor binding protein 2, 36kDa
sheep(443469) insulin-like growth factor binding protein 2, 36kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000597 Rosetta Predictions human pricing
NM_013122 Rosetta Predictions rat pricing
NM_008342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302878 predicted 926
2 SASI_Hs01_00039595 predicted 1032
3 SASI_Hs01_00039597 predicted 931
4 SASI_Hs01_00039598 predicted 559
5 SASI_Hs01_00039599 predicted 1039
6 SASI_Hs01_00039600 predicted 570
7 SASI_Hs01_00039601 predicted 804
8 SASI_Hs01_00039602 predicted 917
9 SASI_Hs01_00039603 predicted 911
10 SASI_Hs01_00039604 predicted 840
11 SASI_Hs01_00039596 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031366 predicted 1038
2 SASI_Rn02_00260900 predicted 809
3 SASI_Rn01_00031367 predicted 800
4 SASI_Rn01_00031368 predicted 814
5 SASI_Rn02_00260901 predicted 816
6 SASI_Rn01_00031370 predicted 959
7 SASI_Rn01_00031369 predicted 493
8 SASI_Rn01_00031372 predicted 722
9 SASI_Rn01_00031371 predicted 498
10 SASI_Rn02_00260902 predicted 962
11 SASI_Rn01_00031373 predicted 807
12 SASI_Rn01_00031374 predicted 498
13 SASI_Rn01_00031375 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048883 predicted 824
2 SASI_Mm01_00048884 predicted 839
3 SASI_Mm01_00048885 predicted 811
4 SASI_Mm01_00048886 predicted 635
5 SASI_Mm01_00048887 predicted 804
6 SASI_Mm01_00048888 predicted 837
7 SASI_Mm01_00048889 predicted 598
8 SASI_Mm01_00048890 predicted 330
9 SASI_Mm01_00048891 predicted 596
10 SASI_Mm01_00048892 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008342
IGFBP2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 2, 36kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-474s21c1
Sequence:CCGGACAGTGATGACGACCACTCTGCTCGAGCAGAGTGGTCGTCATCACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008342.2-1124s21c1
Sequence:CCGGAGACCAACACTGAGCTCAGAACTCGAGTTCTGAGCTCAGTGTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-600s21c1
Sequence:CCGGTGTTCCGGGAGAAGGTCAATGCTCGAGCATTGACCTTCTCCCGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-536s21c1
Sequence:CCGGATGTTGGGAGGTGGTAGCAGTCTCGAGACTGCTACCACCTCCCAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008342.2-1180s1c1
Sequence:CCGGGAACCTCCCTTGCTTCTGTTACTCGAGTAACAGAAGCAAGGGAGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-838s1c1
Sequence:CCGGGCAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-985s1c1
Sequence:CCGGCCATGCCCAAAGTGTGCAGTACTCGAGTACTGCACACTTTGGGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-514s1c1
Sequence:CCGGCCACGTGGATGGGACCATGAACTCGAGTTCATGGTCCCATCCACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-940s1c1
Sequence:CCGGCGAGTGCCATCTCTTCTACAACTCGAGTTGTAGAAGAGATGGCACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008342
IGFBP2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 2, 36kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-474s21c1
Sequence:CCGGACAGTGATGACGACCACTCTGCTCGAGCAGAGTGGTCGTCATCACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008342.2-1124s21c1
Sequence:CCGGAGACCAACACTGAGCTCAGAACTCGAGTTCTGAGCTCAGTGTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-600s21c1
Sequence:CCGGTGTTCCGGGAGAAGGTCAATGCTCGAGCATTGACCTTCTCCCGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-536s21c1
Sequence:CCGGATGTTGGGAGGTGGTAGCAGTCTCGAGACTGCTACCACCTCCCAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008342.2-1180s1c1
Sequence:CCGGGAACCTCCCTTGCTTCTGTTACTCGAGTAACAGAAGCAAGGGAGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-838s1c1
Sequence:CCGGGCAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-985s1c1
Sequence:CCGGCCATGCCCAAAGTGTGCAGTACTCGAGTACTGCACACTTTGGGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-514s1c1
Sequence:CCGGCCACGTGGATGGGACCATGAACTCGAGTTCATGGTCCCATCCACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-940s1c1
Sequence:CCGGCGAGTGCCATCTCTTCTACAACTCGAGTTGTAGAAGAGATGGCACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008342
IGFBP2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 2, 36kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-474s21c1
Sequence:CCGGACAGTGATGACGACCACTCTGCTCGAGCAGAGTGGTCGTCATCACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422736    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008342.2-1124s21c1
Sequence:CCGGAGACCAACACTGAGCTCAGAACTCGAGTTCTGAGCTCAGTGTTGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-600s21c1
Sequence:CCGGTGTTCCGGGAGAAGGTCAATGCTCGAGCATTGACCTTCTCCCGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008342.2-536s21c1
Sequence:CCGGATGTTGGGAGGTGGTAGCAGTCTCGAGACTGCTACCACCTCCCAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008342.2-1180s1c1
Sequence:CCGGGAACCTCCCTTGCTTCTGTTACTCGAGTAACAGAAGCAAGGGAGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-838s1c1
Sequence:CCGGGCAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-985s1c1
Sequence:CCGGCCATGCCCAAAGTGTGCAGTACTCGAGTACTGCACACTTTGGGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-514s1c1
Sequence:CCGGCCACGTGGATGGGACCATGAACTCGAGTTCATGGTCCCATCCACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008342.2-940s1c1
Sequence:CCGGCGAGTGCCATCTCTTCTACAACTCGAGTTGTAGAAGAGATGGCACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000597
IGFBP2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 2, 36kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-615s21c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-930s21c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000597.2-1206s21c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-939s21c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-559s1c1
Sequence:CCGGCAGGTTGCAGACAATGGCGATCTCGAGATCGCCATTGTCTGCAACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000597.1-1203s1c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-936s1c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-612s1c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-927s1c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000597
IGFBP2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 2, 36kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-615s21c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-930s21c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000597.2-1206s21c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-939s21c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-559s1c1
Sequence:CCGGCAGGTTGCAGACAATGGCGATCTCGAGATCGCCATTGTCTGCAACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000597.1-1203s1c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-936s1c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-612s1c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-927s1c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000597
IGFBP2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 2, 36kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-615s21c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-930s21c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000597.2-1206s21c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000597.2-939s21c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-559s1c1
Sequence:CCGGCAGGTTGCAGACAATGGCGATCTCGAGATCGCCATTGTCTGCAACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000597.1-1203s1c1
Sequence:CCGGCCAGTTCTGACACACGTATTTCTCGAGAAATACGTGTGTCAGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-936s1c1
Sequence:CCGGACAGTGCAAGATGTCTCTGAACTCGAGTTCAGAGACATCTTGCACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-612s1c1
Sequence:CCGGCGTGGACAGCACCATGAACATCTCGAGATGTTCATGGTGCTGTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000597.1-927s1c1
Sequence:CCGGCAACCTCAAACAGTGCAAGATCTCGAGATCTTGCACTGTTTGAGGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)