EMAIL THIS PAGE TO A FRIEND

IGFBP3

insulin-like growth factor binding protein 3

96 Gene Product Result for
Synonyms: BP-53 IBP3
UniProtKB ID: P17936, A4D2F5, D3DVM0, Q2V509, Q6P1M6, Q9UCL4
Gene ID:
Human(3486) Summary: This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(16009) insulin-like growth factor binding protein 3
Rat(24484) insulin-like growth factor binding protein 3
Zebrafish(403079) insulin-like growth factor binding protein 3
chicken(420790) insulin-like growth factor binding protein 3
dog(491618) insulin-like growth factor binding protein 3
domestic cat(101080442) insulin-like growth factor binding protein 3
cow(282261) insulin-like growth factor binding protein 3
sheep(100286737) insulin-like growth factor binding protein 3
domestic guinea pig(100714097) insulin-like growth factor binding protein 3
naked mole-rat(101710997) insulin-like growth factor binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000598 Rosetta Predictions human pricing
NM_001013398 Rosetta Predictions human pricing
NM_012588 Rosetta Predictions rat pricing
NM_008343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023290 predicted 1413
2 SASI_Hs01_00023292 predicted 1415
3 SASI_Hs01_00023293 predicted 1414
4 SASI_Hs01_00023295 predicted 648
5 SASI_Hs02_00302879 predicted 1289
6 SASI_Hs02_00302880 predicted 629
7 SASI_Hs02_00302881 predicted 994
8 SASI_Hs01_00023298 predicted 1018
9 SASI_Hs01_00023299 predicted 1096
10 SASI_Hs02_00302882 predicted 664
11 SASI_Hs01_00023291 predicted 786
12 SASI_Hs01_00023294 predicted 684
13 SASI_Hs01_00023296 predicted 1225
14 SASI_Hs01_00023297 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029770 predicted 1435
2 SASI_Hs01_00029772 predicted 1430
3 SASI_Hs01_00029773 predicted 1440
4 SASI_Hs01_00029775 predicted 669
5 SASI_Hs02_00306350 predicted 1308
6 SASI_Hs01_00029779 predicted 1034
7 SASI_Hs02_00306351 predicted 1107
8 SASI_Hs02_00306352 predicted 1038
9 SASI_Hs02_00306353 predicted 680
10 SASI_Hs02_00306354 predicted 774
11 SASI_Hs01_00029771 predicted 811
12 SASI_Hs01_00029774 predicted 708
13 SASI_Hs01_00029776 predicted 1240
14 SASI_Hs01_00029777 predicted 1051
15 SASI_Hs01_00029778 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259729 predicted 665
2 SASI_Rn01_00103702 predicted 625
3 SASI_Rn02_00259730 predicted 650
4 SASI_Rn01_00103703 predicted 1350
5 SASI_Rn01_00103704 predicted 609
6 SASI_Rn01_00103705 predicted 469
7 SASI_Rn01_00103706 predicted 596
8 SASI_Rn01_00103708 predicted 1390
9 SASI_Rn02_00259731 predicted 543
10 SASI_Rn02_00259732 predicted 545
11 SASI_Rn01_00103700 predicted 646
12 SASI_Rn01_00103701 predicted 416
13 SASI_Rn01_00103707 predicted 564
14 SASI_Rn01_00103709 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131709 predicted 638
2 SASI_Mm01_00131710 predicted 635
3 SASI_Mm02_00313680 predicted 1492
4 SASI_Mm02_00313681 predicted 1397
5 SASI_Mm01_00131712 predicted 792
6 SASI_Mm01_00131714 predicted 693
7 SASI_Mm02_00313682 predicted 1394
8 SASI_Mm01_00131716 predicted 697
9 SASI_Mm01_00131717 predicted 784
10 SASI_Mm02_00313683 predicted 1441
11 SASI_Mm01_00131711 predicted 688
12 SASI_Mm01_00131713 predicted 728
13 SASI_Mm01_00131715 predicted 635
14 SASI_Mm01_00131718 predicted 682
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000598
VALIDATED
IGFBP3 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-681s1c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-797s21c1
Sequence:CCGGATCACCTGAAGTTCCTCAATGCTCGAGCATTGAGGAACTTCAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-681s21c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000598.4-1095s21c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-1095s1c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-633s1c1
Sequence:CCGGCCTCCATTCAAAGATAATCATCTCGAGATGATTATCTTTGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-711s1c1
Sequence:CCGGGAGCACAGATACCCAGAACTTCTCGAGAAGTTCTGGGTATCTGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-770s1c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-770s21c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-742s21c1
Sequence:CCGGTCCAAGCGGGAGACAGAATATCTCGAGATATTCTGTCTCCCGCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000598
VALIDATED
IGFBP3 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-681s1c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-797s21c1
Sequence:CCGGATCACCTGAAGTTCCTCAATGCTCGAGCATTGAGGAACTTCAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-681s21c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000598.4-1095s21c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-1095s1c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-633s1c1
Sequence:CCGGCCTCCATTCAAAGATAATCATCTCGAGATGATTATCTTTGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-711s1c1
Sequence:CCGGGAGCACAGATACCCAGAACTTCTCGAGAAGTTCTGGGTATCTGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-770s1c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-770s21c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-742s21c1
Sequence:CCGGTCCAAGCGGGAGACAGAATATCTCGAGATATTCTGTCTCCCGCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000598
VALIDATED
IGFBP3 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-681s1c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-797s21c1
Sequence:CCGGATCACCTGAAGTTCCTCAATGCTCGAGCATTGAGGAACTTCAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-681s21c1
Sequence:CCGGCCAGCGCTACAAAGTTGACTACTCGAGTAGTCAACTTTGTAGCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286843    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000598.4-1095s21c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072508    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-1095s1c1
Sequence:CCGGGCCTCGATTTATATTTCTGTTCTCGAGAACAGAAATATAAATCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-633s1c1
Sequence:CCGGCCTCCATTCAAAGATAATCATCTCGAGATGATTATCTTTGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000598.4-711s1c1
Sequence:CCGGGAGCACAGATACCCAGAACTTCTCGAGAAGTTCTGGGTATCTGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000598.4-770s1c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-770s21c1
Sequence:CCGGGCCGTAGAGAAATGGAAGACACTCGAGTGTCTTCCATTTCTCTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000598.4-742s21c1
Sequence:CCGGTCCAAGCGGGAGACAGAATATCTCGAGATATTCTGTCTCCCGCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008343
VALIDATED
IGFBP3 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-747s1c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-792s1c1
Sequence:CCGGCATCCCAAACTGTGACAAGAACTCGAGTTCTTGTCACAGTTTGGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-592s1c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-486s1c1
Sequence:CCGGAGGAAACATCAGTGAGTCCGACTCGAGTCGGACTCACTGATGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-562s1c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-799s21c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-614s21c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1402s21c1
Sequence:CCGGGACGTTCCGTGGCTGATATAGCTCGAGCTATATCAGCCACGGAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-644s21c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1012s21c1
Sequence:CCGGGATGCTCCGTGCCACATAATACTCGAGTATTATGTGGCACGGAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008343
VALIDATED
IGFBP3 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-747s1c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-792s1c1
Sequence:CCGGCATCCCAAACTGTGACAAGAACTCGAGTTCTTGTCACAGTTTGGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-592s1c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-486s1c1
Sequence:CCGGAGGAAACATCAGTGAGTCCGACTCGAGTCGGACTCACTGATGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-562s1c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-799s21c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-614s21c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1402s21c1
Sequence:CCGGGACGTTCCGTGGCTGATATAGCTCGAGCTATATCAGCCACGGAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-644s21c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1012s21c1
Sequence:CCGGGATGCTCCGTGCCACATAATACTCGAGTATTATGTGGCACGGAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008343
VALIDATED
IGFBP3 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-747s1c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-792s1c1
Sequence:CCGGCATCCCAAACTGTGACAAGAACTCGAGTTCTTGTCACAGTTTGGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-592s1c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008343.1-486s1c1
Sequence:CCGGAGGAAACATCAGTGAGTCCGACTCGAGTCGGACTCACTGATGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008343.1-562s1c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-799s21c1
Sequence:CCGGGAATCATCTGAAGTTCCTCAACTCGAGTTGAGGAACTTCAGATGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-614s21c1
Sequence:CCGGGTGACCGATTCCAAGTTCCATCTCGAGATGGAACTTGGAATCGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1402s21c1
Sequence:CCGGGACGTTCCGTGGCTGATATAGCTCGAGCTATATCAGCCACGGAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-644s21c1
Sequence:CCGGGCCAAGATGGATGTCATCAAACTCGAGTTTGATGACATCCATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008343.2-1012s21c1
Sequence:CCGGGATGCTCCGTGCCACATAATACTCGAGTATTATGTGGCACGGAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)