EMAIL THIS PAGE TO A FRIEND

IGFBP4

insulin-like growth factor binding protein 4

81 Gene Product Result for
Synonyms: BP-4 HT29-IGFBP IBP4 IGFBP-4
UniProtKB ID: P22692, A0N9W2, Q5U012, Q9UCL6
Gene ID:
Human(3487) Summary: This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma in both glycosylated and non-glycosylated forms. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors. [provided by RefSeq, Jul 2008]
Mouse(16010) insulin-like growth factor binding protein 4
Rat(360622) insulin-like growth factor binding protein 4
Goat(100860812) insulin-like growth factor binding protein 4
sheep(443470) insulin-like growth factor binding protein 4
domestic guinea pig(100730717) insulin-like growth factor binding protein 4
naked mole-rat(101720021) insulin-like growth factor binding protein 4
chicken(374271) insulin-like growth factor binding protein 4
cow(282262) insulin-like growth factor binding protein 4
domestic cat(101082792) insulin-like growth factor binding protein 4
dog(608158) insulin-like growth factor binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001552 siRNAs that have been validated in the lab human pricing
NM_001004274 Rosetta Predictions rat pricing
XM_579134 Rosetta Predictions rat pricing
NM_010517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001552 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121448 validated 1529
1 SASI_Hs01_00121446 validated 721
1 SASI_Hs01_00121450 validated 1335
2 SASI_Hs02_00332110 predicted 610
3 SASI_Hs01_00121447 predicted 717
4 SASI_Hs01_00121449 predicted 1513
5 SASI_Hs01_00121451 predicted 1510
6 SASI_Hs01_00121452 predicted 1537
7 SASI_Hs01_00121453 predicted 1357
8 SASI_Hs01_00121454 predicted 1370
9 SASI_Hs01_00121455 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198307 predicted 901
2 SASI_Rn01_00098235 predicted 671
3 SASI_Rn01_00098236 predicted 861
4 SASI_Rn01_00098237 predicted 798
5 SASI_Rn01_00098239 predicted 509
6 SASI_Rn01_00098240 predicted 585
7 SASI_Rn01_00098241 predicted 879
8 SASI_Rn02_00198308 predicted 401
9 SASI_Rn01_00098238 predicted 671
10 SASI_Rn01_00098243 predicted 1451
11 SASI_Rn01_00098242 predicted 639
12 SASI_Rn01_00098244 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185546 predicted 367
2 SASI_Rn01_00185547 predicted 568
3 SASI_Rn01_00185548 predicted 370
4 SASI_Rn01_00185549 predicted 450
5 SASI_Rn01_00185550 predicted 316
6 SASI_Rn01_00185551 predicted 631
7 SASI_Rn01_00185552 predicted 501
8 SASI_Rn01_00185553 predicted 568
9 SASI_Rn01_00185554 predicted 440
10 SASI_Rn01_00185555 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027626 predicted 673
2 SASI_Mm02_00318788 predicted 1346
3 SASI_Mm01_00027624 predicted 1239
4 SASI_Mm02_00318789 predicted 1240
5 SASI_Mm01_00027625 predicted 1378
6 SASI_Mm02_00318790 predicted 1382
7 SASI_Mm01_00027627 predicted 1210
8 SASI_Mm01_00027628 predicted 1440
9 SASI_Mm01_00027629 predicted 1467
10 SASI_Mm01_00027631 predicted 1449
11 SASI_Mm01_00027623 predicted 684
12 SASI_Mm01_00027630 predicted 651
13 SASI_Mm01_00027632 predicted 1490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001552
VALIDATED
IGFBP4 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1416s21c1
Sequence:CCGGTCACTCATCCAGCCACCTAAACTCGAGTTTAGGTGGCTGGATGAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1198s21c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1518s21c1
Sequence:CCGGATGTGGAGACACTCCTATAAGCTCGAGCTTATAGGAGTGTCTCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001552.2-727s21c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1493s21c1
Sequence:CCGGTATTCTGACTTCCTCTGATTTCTCGAGAAATCAGAGGAAGTCAGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001552.2-583s1c2
Sequence:CCGGCACACACTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAGTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1065s1c1
Sequence:CCGGGCTGGCTGACAGCTTTCGAGACTCGAGTCTCGAAAGCTGTCAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-727s1c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1198s1c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1545s21c1
Sequence:CCGGTCAAGCCTGTGGGAGTAGAAACTCGAGTTTCTACTCCCACAGGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001552
VALIDATED
IGFBP4 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1416s21c1
Sequence:CCGGTCACTCATCCAGCCACCTAAACTCGAGTTTAGGTGGCTGGATGAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1198s21c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1518s21c1
Sequence:CCGGATGTGGAGACACTCCTATAAGCTCGAGCTTATAGGAGTGTCTCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001552.2-727s21c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1493s21c1
Sequence:CCGGTATTCTGACTTCCTCTGATTTCTCGAGAAATCAGAGGAAGTCAGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001552.2-583s1c2
Sequence:CCGGCACACACTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAGTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1065s1c1
Sequence:CCGGGCTGGCTGACAGCTTTCGAGACTCGAGTCTCGAAAGCTGTCAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-727s1c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1198s1c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1545s21c1
Sequence:CCGGTCAAGCCTGTGGGAGTAGAAACTCGAGTTTCTACTCCCACAGGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001552
VALIDATED
IGFBP4 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1416s21c1
Sequence:CCGGTCACTCATCCAGCCACCTAAACTCGAGTTTAGGTGGCTGGATGAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1198s21c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1518s21c1
Sequence:CCGGATGTGGAGACACTCCTATAAGCTCGAGCTTATAGGAGTGTCTCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001552.2-727s21c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1493s21c1
Sequence:CCGGTATTCTGACTTCCTCTGATTTCTCGAGAAATCAGAGGAAGTCAGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001552.2-583s1c2
Sequence:CCGGCACACACTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAGTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1065s1c1
Sequence:CCGGGCTGGCTGACAGCTTTCGAGACTCGAGTCTCGAAAGCTGTCAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-727s1c1
Sequence:CCGGCTGCAGAAGCACTTCGCCAAACTCGAGTTTGGCGAAGTGCTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001552.2-1198s1c1
Sequence:CCGGGCCCAGAAGTTTCCCTCAAATCTCGAGATTTGAGGGAAACTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001552.2-1545s21c1
Sequence:CCGGTCAAGCCTGTGGGAGTAGAAACTCGAGTTTCTACTCCCACAGGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010517
VALIDATED
IGFBP4 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010517.3-1921s21c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-586s21c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-825s21c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-586s1c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-1921s1c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-392s1c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-508s1c1
Sequence:CCGGCGTACATTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAATGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-825s1c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-392s21c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010517
VALIDATED
IGFBP4 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010517.3-1921s21c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-586s21c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-825s21c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-586s1c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-1921s1c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-392s1c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-508s1c1
Sequence:CCGGCGTACATTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAATGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-825s1c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-392s21c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010517
VALIDATED
IGFBP4 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010517.3-1921s21c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-586s21c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-825s21c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-586s1c1
Sequence:CCGGGACAAGGATGAGAGCGAACATCTCGAGATGTTCGCTCTCATCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114796    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-1921s1c1
Sequence:CCGGCCCTACCCTTATACCTCCTATCTCGAGATAGGAGGTATAAGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010517.2-392s1c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-508s1c1
Sequence:CCGGCGTACATTGATGCACGGGCAACTCGAGTTGCCCGTGCATCAATGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010517.2-825s1c1
Sequence:CCGGCATTCCAAACTGTGACCGCAACTCGAGTTGCGGTCACAGTTTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010517.3-392s21c1
Sequence:CCGGGCTGCGGTTGTTGCGCCACTTCTCGAGAAGTGGCGCAACAACCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)