EMAIL THIS PAGE TO A FRIEND

IGFBP5

insulin-like growth factor binding protein 5

89 Gene Product Result for
Synonyms: IBP5
UniProtKB ID: P24593, Q5U0A3
Gene ID:
Mouse(16011) insulin-like growth factor binding protein 5
Rat(25285) insulin-like growth factor binding protein 5
chicken(424220) insulin-like growth factor binding protein 5
cow(404185) insulin-like growth factor binding protein 5
domestic cat(101084305) insulin-like growth factor binding protein 5
dog(610316) insulin-like growth factor binding protein 5
domestic guinea pig(100724427) insulin-like growth factor binding protein 5
naked mole-rat(101716815) insulin-like growth factor binding protein 5
sheep(443133) insulin-like growth factor binding protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000599 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149811 MISSION® esiRNA esiRNA human IGFBP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000599 Rosetta Predictions human pricing
NM_012817 Rosetta Predictions rat pricing
NM_010518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141338 predicted 1515
2 SASI_Hs01_00141339 predicted 1770
3 SASI_Hs01_00141340 predicted 1771
4 SASI_Hs01_00141341 predicted 1957
5 SASI_Hs01_00141342 predicted 2054
6 SASI_Hs01_00141343 predicted 1420
7 SASI_Hs01_00141344 predicted 1312
8 SASI_Hs01_00141345 predicted 2045
9 SASI_Hs01_00141346 predicted 1221
10 SASI_Hs02_00302883 predicted 2050
11 SASI_Hs01_00141347 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100192 predicted 884
2 SASI_Rn01_00100193 predicted 1083
3 SASI_Rn01_00100194 predicted 731
4 SASI_Rn01_00100195 predicted 971
5 SASI_Rn01_00100196 predicted 996
6 SASI_Rn01_00100197 predicted 1075
7 SASI_Rn01_00100198 predicted 1014
8 SASI_Rn01_00100199 predicted 905
9 SASI_Rn01_00100200 predicted 989
10 SASI_Rn01_00100201 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183756 predicted 1268
2 SASI_Mm01_00183758 predicted 1958
3 SASI_Mm01_00183760 predicted 1063
4 SASI_Mm01_00183761 predicted 1951
5 SASI_Mm02_00318791 predicted 1144
6 SASI_Mm01_00183762 predicted 1242
7 SASI_Mm01_00183763 predicted 905
8 SASI_Mm01_00183764 predicted 1167
9 SASI_Mm01_00183765 predicted 2009
10 SASI_Mm02_00318792 predicted 1887
11 SASI_Mm01_00183757 predicted 1685
12 SASI_Mm01_00183759 predicted 1835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010518
IGFBP5 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1967s21c1
Sequence:CCGGAGTGACACCCAGTTTAGATTGCTCGAGCAATCTAAACTGGGTGTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1285s1c1
Sequence:CCGGGAGATGAGACAGGAATCCGAACTCGAGTTCGGATTCCTGTCTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-834s1c1
Sequence:CCGGCGACGAGAAAGCTCTGTCCATCTCGAGATGGACAGAGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010518.1-1636s1c1
Sequence:CCGGCGTCACTCATTTCATCTCATTCTCGAGAATGAGATGAAATGAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1470s1c1
Sequence:CCGGTGTGGACAAGTACGGAATGAACTCGAGTTCATTCCGTACTTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1530s1c1
Sequence:CCGGCCACGCCTTCGACAGCAGTAACTCGAGTTACTGCTGTCGAAGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1844s21c1
Sequence:CCGGGAAGGACAGATAGGATTAGAGCTCGAGCTCTAATCCTATCTGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1101s21c1
Sequence:CCGGGATGGCTGAAGAGACCTACTCCTCGAGGAGTAGGTCTCTTCAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1040s21c1
Sequence:CCGGACGGCGAGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCTCGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010518
IGFBP5 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1967s21c1
Sequence:CCGGAGTGACACCCAGTTTAGATTGCTCGAGCAATCTAAACTGGGTGTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1285s1c1
Sequence:CCGGGAGATGAGACAGGAATCCGAACTCGAGTTCGGATTCCTGTCTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-834s1c1
Sequence:CCGGCGACGAGAAAGCTCTGTCCATCTCGAGATGGACAGAGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010518.1-1636s1c1
Sequence:CCGGCGTCACTCATTTCATCTCATTCTCGAGAATGAGATGAAATGAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1470s1c1
Sequence:CCGGTGTGGACAAGTACGGAATGAACTCGAGTTCATTCCGTACTTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1530s1c1
Sequence:CCGGCCACGCCTTCGACAGCAGTAACTCGAGTTACTGCTGTCGAAGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1844s21c1
Sequence:CCGGGAAGGACAGATAGGATTAGAGCTCGAGCTCTAATCCTATCTGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1101s21c1
Sequence:CCGGGATGGCTGAAGAGACCTACTCCTCGAGGAGTAGGTCTCTTCAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1040s21c1
Sequence:CCGGACGGCGAGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCTCGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010518
IGFBP5 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1967s21c1
Sequence:CCGGAGTGACACCCAGTTTAGATTGCTCGAGCAATCTAAACTGGGTGTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1285s1c1
Sequence:CCGGGAGATGAGACAGGAATCCGAACTCGAGTTCGGATTCCTGTCTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-834s1c1
Sequence:CCGGCGACGAGAAAGCTCTGTCCATCTCGAGATGGACAGAGCTTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010518.1-1636s1c1
Sequence:CCGGCGTCACTCATTTCATCTCATTCTCGAGAATGAGATGAAATGAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1470s1c1
Sequence:CCGGTGTGGACAAGTACGGAATGAACTCGAGTTCATTCCGTACTTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010518.1-1530s1c1
Sequence:CCGGCCACGCCTTCGACAGCAGTAACTCGAGTTACTGCTGTCGAAGGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010518.2-1844s21c1
Sequence:CCGGGAAGGACAGATAGGATTAGAGCTCGAGCTCTAATCCTATCTGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1101s21c1
Sequence:CCGGGATGGCTGAAGAGACCTACTCCTCGAGGAGTAGGTCTCTTCAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010518.2-1040s21c1
Sequence:CCGGACGGCGAGCAAACCAAGATAGCTCGAGCTATCTTGGTTTGCTCGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000599
VALIDATED
IGFBP5 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1301s1c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1436s21c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000599.2-863s1c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1098s21c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1435s1c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1097s1c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1407s1c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1408s21c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-864s21c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1302s21c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000599
VALIDATED
IGFBP5 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1301s1c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1436s21c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000599.2-863s1c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1098s21c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1435s1c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1097s1c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1407s1c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1408s21c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-864s21c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1302s21c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000599
VALIDATED
IGFBP5 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1301s1c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1436s21c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_000599.2-863s1c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1098s21c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1435s1c1
Sequence:CCGGGCAAAGGATTCTACAAGAGAACTCGAGTTCTCTTGTAGAATCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1097s1c1
Sequence:CCGGGCAAGTCAAGATCGAGAGAGACTCGAGTCTCTCTCGATCTTGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000599.2-1407s1c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1408s21c1
Sequence:CCGGCGTGCTGTGTACCTGCCCAATCTCGAGATTGGGCAGGTACACAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-864s21c1
Sequence:CCGGCGACGAGAAAGCCCTCTCCATCTCGAGATGGAGAGGGCTTTCTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000599.3-1302s21c1
Sequence:CCGGGATCATCTCTGCACCTGAGATCTCGAGATCTCAGGTGCAGAGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)