EMAIL THIS PAGE TO A FRIEND

IGFBP6

insulin-like growth factor binding protein 6

68 Gene Product Result for
Synonyms: IBP6
UniProtKB ID: P24592, Q14492
Gene ID:
Mouse(16012) insulin-like growth factor binding protein 6
Rat(25641) insulin-like growth factor binding protein 6
dog(607374) insulin-like growth factor binding protein 6
cow(404186) insulin-like growth factor binding protein 6
domestic cat(101082759) insulin-like growth factor binding protein 6
sheep(100187551) insulin-like growth factor binding protein 6
domestic guinea pig(100734564) insulin-like growth factor binding protein 6
naked mole-rat(101718019) insulin-like growth factor binding protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002178 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002178 Rosetta Predictions human pricing
NM_013104 Rosetta Predictions rat pricing
NM_008344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151322 predicted 737
2 SASI_Hs01_00151323 predicted 537
3 SASI_Hs01_00151324 predicted 633
4 SASI_Hs01_00151325 predicted 553
5 SASI_Hs01_00151326 predicted 450
6 SASI_Hs01_00151327 predicted 514
7 SASI_Hs01_00151328 predicted 639
8 SASI_Hs01_00151329 predicted 607
9 SASI_Hs01_00151330 predicted 507
10 SASI_Hs01_00151331 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071708 predicted 530
2 SASI_Rn01_00071710 predicted 506
3 SASI_Rn02_00260871 predicted 255
4 SASI_Rn01_00071712 predicted 514
5 SASI_Rn01_00071713 predicted 511
6 SASI_Rn01_00071714 predicted 305
7 SASI_Rn01_00071715 predicted 519
8 SASI_Rn01_00071716 predicted 495
9 SASI_Rn02_00260872 predicted 256
10 SASI_Rn02_00260873 predicted 628
11 SASI_Rn01_00071709 predicted 412
12 SASI_Rn01_00071711 predicted 643
13 SASI_Rn01_00071717 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083427 predicted 800
2 SASI_Mm01_00083428 predicted 804
3 SASI_Mm01_00083429 predicted 633
4 SASI_Mm01_00083430 predicted 805
5 SASI_Mm01_00083432 predicted 639
6 SASI_Mm01_00083431 predicted 635
7 SASI_Mm01_00083435 predicted 637
8 SASI_Mm01_00083433 predicted 1015
9 SASI_Mm01_00083434 predicted 903
10 SASI_Mm02_00313684 predicted 924
11 SASI_Mm01_00083436 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008344
VALIDATED
IGFBP6 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-930s21c1
Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-804s21c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-1132s21c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-703s21c1
Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-843s21c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008344.1-962s1c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-673s1c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-864s1c1
Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-455s1c1
Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-634s1c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008344
VALIDATED
IGFBP6 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-930s21c1
Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-804s21c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-1132s21c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-703s21c1
Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-843s21c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008344.1-962s1c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-673s1c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-864s1c1
Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-455s1c1
Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-634s1c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008344
VALIDATED
IGFBP6 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-930s21c1
Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-804s21c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-1132s21c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-703s21c1
Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008344.3-843s21c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008344.1-962s1c1
Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-673s1c1
Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-864s1c1
Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-455s1c1
Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008344.1-634s1c1
Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002178
VALIDATED
IGFBP6 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-393s21c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-409s21c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-466s21c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-829s21c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-829s1c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-466s1c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-409s1c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-613s1c1
Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-393s1c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002178
VALIDATED
IGFBP6 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-393s21c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-409s21c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-466s21c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-829s21c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-829s1c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-466s1c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-409s1c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-613s1c1
Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-393s1c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002178
VALIDATED
IGFBP6 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-393s21c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-409s21c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-466s21c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002178.2-829s21c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-829s1c1
Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-466s1c1
Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-409s1c1
Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-613s1c1
Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002178.2-393s1c1
Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)