IGFBP6

insulin-like growth factor binding protein 6

68 Gene Product Result for

Synonyms: IBP6

Species: Human IGFBP6(3489), Mouse Igfbp6(16012), Rat Igfbp6(25641), dog IGFBP6(607374), cow IGFBP6(404186), domestic cat IGFBP6(101082759), sheep IGFBP6(100187551), domestic guinea pig Igfbp6(100734564), naked mole-rat Igfbp6(101718019)

UniProtKB ID: P24592, Q14492

Gene ID:

Human(3489)

Mouse(16012) insulin-like growth factor binding protein 6

Rat(25641) insulin-like growth factor binding protein 6

dog(607374) insulin-like growth factor binding protein 6

cow(404186) insulin-like growth factor binding protein 6

domestic cat(101082759) insulin-like growth factor binding protein 6

sheep(100187551) insulin-like growth factor binding protein 6

domestic guinea pig(100734564) insulin-like growth factor binding protein 6

naked mole-rat(101718019) insulin-like growth factor binding protein 6

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

GW22240	Anti-IGFBP6 antibody produced in chicken affinity isolated antibody, buffered aqueous solution	human	western blot	pricing

SAB2500534	Anti-IGFBP6 antibody produced in goat affinity isolated antibody, buffered aqueous solution	human	ELISA, immunohistochemistry, western blot	pricing

HPA008005	Anti-IGFBP6 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB1408590	Anti-IGFBP6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

SAB1412720	Monoclonal Anti-IGFBP6 antibody produced in mouse clone 1A8, purified immunoglobulin	human	ELISA, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN10525	CompoZr^® Knockout ZFN Kit Human IGFBP6 (NM_002178)	pricing

CKOZFN33694	CompoZr^® Knockout ZFN Kit Mouse Igfbp6 (NM_008344.3)	pricing

CKOZFN55366	CompoZr^® Knockout ZFN Kit Rat Igfbp6 (NM_013104)	pricing

CKOZFND10525	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human IGFBP6 (NM_002178)	pricing

CKOZFND33694	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Igfbp6 (NM_008344.3)	pricing

CKOZFND55366	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Igfbp6 (NM_013104)	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP3065	IGF-Binding Protein 6 human recombinant, expressed in (BTI-Tn-5B1-4) High-5 Insect Cells, ≥95% (SDS-PAGE), ≥95% (HPLC), cell culture tested	human	pricing

I9029	Insulin-like Growth Factor Binding Protein-6 human >97% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder	human	pricing

APREST86674	PrEST Antigen IGFBP6 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST23780	SILu^™PrEST IBP6 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0240	Human IGFBP-6 ELISA Kit for serum, plasma, cell culture supernatant and urine	human	pricing

RAB0241	Mouse IGFBP-6 ELISA Kit for serum, plasma and cell culture supernatant	mouse	pricing

RAB0902	Rat Igfbp6 / Insulin-like Growth Factor-binding Protein 6 ELISA Kit	rat	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR00306	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, IGFBP6	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_008344	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_008344	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_008344	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_002178	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_002178	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_002178	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU058281	MISSION^® esiRNA esiRNA human IGFBP6 (esiRNA1)	human	pricing

EMU006981	MISSION^® esiRNA esiRNA targeting mouse Igfbp6 (esiRNA1)	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_002178	Rosetta Predictions	human	pricing
NM_013104	Rosetta Predictions	rat	pricing
NM_008344	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_002178	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00151322 predicted	737
2	SASI_Hs01_00151323 predicted	537
3	SASI_Hs01_00151324 predicted	633
4	SASI_Hs01_00151325 predicted	553
5	SASI_Hs01_00151326 predicted	450
6	SASI_Hs01_00151327 predicted	514
7	SASI_Hs01_00151328 predicted	639
8	SASI_Hs01_00151329 predicted	607
9	SASI_Hs01_00151330 predicted	507
10	SASI_Hs01_00151331 predicted	509

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_013104	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00071708 predicted	530
2	SASI_Rn01_00071710 predicted	506
3	SASI_Rn02_00260871 predicted	255
4	SASI_Rn01_00071712 predicted	514
5	SASI_Rn01_00071713 predicted	511
6	SASI_Rn01_00071714 predicted	305
7	SASI_Rn01_00071715 predicted	519
8	SASI_Rn01_00071716 predicted	495
9	SASI_Rn02_00260872 predicted	256
10	SASI_Rn02_00260873 predicted	628
11	SASI_Rn01_00071709 predicted	412
12	SASI_Rn01_00071711 predicted	643
13	SASI_Rn01_00071717 predicted	517

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_008344	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00083427 predicted	800
2	SASI_Mm01_00083428 predicted	804
3	SASI_Mm01_00083429 predicted	633
4	SASI_Mm01_00083430 predicted	805
5	SASI_Mm01_00083432 predicted	639
6	SASI_Mm01_00083431 predicted	635
7	SASI_Mm01_00083435 predicted	637
8	SASI_Mm01_00083433 predicted	1015
9	SASI_Mm01_00083434 predicted	903
10	SASI_Mm02_00313684 predicted	924
11	SASI_Mm01_00083436 predicted	679

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_008344 VALIDATED	IGFBP6 MISSION shRNA Bacterial Glycerol Stock insulin-like growth factor binding protein 6	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000328226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-804s21c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-843s21c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-703s21c1
	Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328298
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-930s21c1
	Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-1132s21c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114766
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008344.1-962s1c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-673s1c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114770
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-455s1c1
	Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114769
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-864s1c1
	Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114767
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-634s1c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_008344 VALIDATED	IGFBP6 MISSION shRNA shRNA Plasmid DNA insulin-like growth factor binding protein 6	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000328226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-804s21c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-843s21c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-703s21c1
	Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328298
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-930s21c1
	Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-1132s21c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114766
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008344.1-962s1c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-673s1c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114770
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-455s1c1
	Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114769
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-864s1c1
	Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114767
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-634s1c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_008344 VALIDATED	IGFBP6 MISSION shRNA Lentiviral Transduction Particles insulin-like growth factor binding protein 6	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000328226
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-804s21c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328227
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-843s21c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328230
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-703s21c1
	Sequence:CCGGAGACTACAAAGGAGAGCAAACCTCGAGGTTTGCTCTCCTTTGTAGTCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328298
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-930s21c1
	Sequence:CCGGCTCAGAGGCTTCTACCGAAAGCTCGAGCTTTCGGTAGAAGCCTCTGAGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000328228
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: NIH/3T3
	TRC Version: 2	Clone ID:NM_008344.3-1132s21c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114766
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_008344.1-962s1c1
	Sequence:CCGGGCTGTATGTGAAGCAATGAATCTCGAGATTCATTGCTTCACATACAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114768
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-673s1c1
	Sequence:CCGGCGCAGACACTTGGATTCAGTACTCGAGTACTGAATCCAAGTGTCTGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114770
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.63	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-455s1c1
	Sequence:CCGGGAGAGAACGAAGAGACGCCTTCTCGAGAAGGCGTCTCTTCGTTCTCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114769
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-864s1c1
	Sequence:CCGGAGATGGTCAAGGAAGCACTCACTCGAGTGAGTGCTTCCTTGACCATCTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000114767
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: NIH/3T3
	TRC Version: 1	Clone ID:NM_008344.1-634s1c1
	Sequence:CCGGCGGCCCAATCCTGTTCAAGATCTCGAGATCTTGAACAGGATTGGGCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_002178 VALIDATED	IGFBP6 MISSION shRNA Bacterial Glycerol Stock insulin-like growth factor binding protein 6	Human

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000310328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-393s21c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310330
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-829s21c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298749
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-466s21c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-829s1c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062406
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-466s1c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062407
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-393s1c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062405
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-613s1c1
	Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062404
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-409s1c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-409s21c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_002178 VALIDATED	IGFBP6 MISSION shRNA shRNA Plasmid DNA insulin-like growth factor binding protein 6	Human

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000310328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-393s21c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310330
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-829s21c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298749
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-466s21c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-829s1c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062406
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-466s1c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062407
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-393s1c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062405
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-613s1c1
	Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062404
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-409s1c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-409s21c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_002178 VALIDATED	IGFBP6 MISSION shRNA Lentiviral Transduction Particles insulin-like growth factor binding protein 6	Human

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000310328
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.67	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-393s21c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000310330
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-829s21c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298749
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-466s21c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062403
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.99	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-829s1c1
	Sequence:CCGGCATGGAGCTGTCATCACTCAACTCGAGTTGAGTGATGACAGCTCCATGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062406
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-466s1c1
	Sequence:CCGGCGCAGAGACCAACAGAGGAATCTCGAGATTCCTCTGTTGGTCTCTGCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062407
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-393s1c1
	Sequence:CCGGGCCTGCTGTTGCAGAGGAGAACTCGAGTTCTCCTCTGCAACAGCAGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062405
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.65	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-613s1c1
	Sequence:CCGGCAAACACTCTACGTGCCCAATCTCGAGATTGGGCACGTAGAGTGTTTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000062404
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_002178.2-409s1c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000298750
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_002178.2-409s21c1
	Sequence:CCGGGAGAATCCTAAGGAGAGTAAACTCGAGTTTACTCTCCTTAGGATTCTCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart