EMAIL THIS PAGE TO A FRIEND

IGFBP7

insulin-like growth factor binding protein 7

68 Gene Product Result for
Synonyms: AGM FSTL2 IBP-7 IGFBP-7 IGFBP-7v IGFBPRP1 MAC25 PSF RAMSVPS TAF
UniProtKB ID: Q16270, B4E1N2, B7Z9W7, Q07822, Q53YE6, Q9UCA8
Gene ID:
Human(3490) Summary: This gene encodes a member of the insulin-like growth factor (IGF)-binding protein (IGFBP) family. IGFBPs bind IGFs with high affinity, and regulate IGF availability in body fluids and tissues and modulate IGF binding to its receptors. This protein binds IGF-I and IGF-II with relatively low affinity, and belongs to a subfamily of low-affinity IGFBPs. It also stimulates prostacyclin production and cell adhesion. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, and one variant has been associated with retinal arterial macroaneurysm (PMID:21835307). [provided by RefSeq, Dec 2011]
Mouse(29817) insulin-like growth factor binding protein 7
Rat(289560) insulin-like growth factor binding protein 7
Zebrafish(405860) insulin-like growth factor binding protein 7
domestic cat(101083263) insulin-like growth factor binding protein 7
cow(616368) insulin-like growth factor binding protein 7
dog(608559) insulin-like growth factor binding protein 7
chicken(422620) insulin-like growth factor binding protein 7
domestic guinea pig(100731297) insulin-like growth factor binding protein 7
naked mole-rat(101717990) insulin-like growth factor binding protein 7
sheep(100270713) insulin-like growth factor binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001553 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001553 Rosetta Predictions human pricing
NM_001013048 Rosetta Predictions rat pricing
NM_008048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00175814 predicted 815
2 SASI_Hs01_00175815 predicted 845
3 SASI_Hs01_00175818 predicted 557
4 SASI_Hs01_00175822 predicted 870
5 SASI_Hs02_00332111 predicted 848
6 SASI_Hs02_00332112 predicted 854
7 SASI_Hs02_00332113 predicted 337
8 SASI_Hs02_00332114 predicted 612
9 SASI_Hs02_00332115 predicted 850
10 SASI_Hs02_00332116 predicted 859
11 SASI_Hs01_00175816 predicted 725
12 SASI_Hs01_00175817 predicted 595
13 SASI_Hs01_00175819 predicted 563
14 SASI_Hs01_00175820 predicted 298
15 SASI_Hs01_00175821 predicted 656
16 SASI_Hs01_00175823 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn02_00200644 predicted 777
2 SASI_Rn01_00077575 predicted 853
3 SASI_Rn01_00077576 predicted 847
4 SASI_Rn01_00077577 predicted 708
5 SASI_Rn01_00077578 predicted 839
6 SASI_Rn01_00077579 predicted 576
7 SASI_Rn01_00077581 predicted 637
8 SASI_Rn01_00077582 predicted 806
9 SASI_Rn01_00077584 predicted 585
10 SASI_Rn02_00200645 predicted 706
11 SASI_Rn01_00077580 predicted 626
12 SASI_Rn01_00077583 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00072720 predicted 617
2 SASI_Mm01_00072721 predicted 828
3 SASI_Mm01_00072722 predicted 820
4 SASI_Mm01_00072723 predicted 856
5 SASI_Mm01_00072725 predicted 642
6 SASI_Mm01_00072726 predicted 564
7 SASI_Mm01_00072727 predicted 865
8 SASI_Mm01_00072728 predicted 718
9 SASI_Mm01_00072729 predicted 759
10 SASI_Mm02_00313010 predicted 486
11 SASI_Mm01_00072724 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008048
IGFBP7 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-836s1c1
Sequence:CCGGCCTCCATGAAATACCACTGAACTCGAGTTCAGTGGTATTTCATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-353s1c1
Sequence:CCGGCCTCGCCGTGTGCGTGTGCAACTCGAGTTGCACACGCACACGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-710s1c1
Sequence:CCGGGCATGAAGTAACGGGCTGGGTCTCGAGACCCAGCCCGTTACTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-392s1c1
Sequence:CCGGCGGCAGCAACGGCATCACCTACTCGAGTAGGTGATGCCGTTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-602s1c1
Sequence:CCGGCCTCATCTGGAACAAGGTAAACTCGAGTTTACCTTGTTCCAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008048
IGFBP7 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-836s1c1
Sequence:CCGGCCTCCATGAAATACCACTGAACTCGAGTTCAGTGGTATTTCATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-353s1c1
Sequence:CCGGCCTCGCCGTGTGCGTGTGCAACTCGAGTTGCACACGCACACGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-710s1c1
Sequence:CCGGGCATGAAGTAACGGGCTGGGTCTCGAGACCCAGCCCGTTACTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-392s1c1
Sequence:CCGGCGGCAGCAACGGCATCACCTACTCGAGTAGGTGATGCCGTTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-602s1c1
Sequence:CCGGCCTCATCTGGAACAAGGTAAACTCGAGTTTACCTTGTTCCAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008048
IGFBP7 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-836s1c1
Sequence:CCGGCCTCCATGAAATACCACTGAACTCGAGTTCAGTGGTATTTCATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-353s1c1
Sequence:CCGGCCTCGCCGTGTGCGTGTGCAACTCGAGTTGCACACGCACACGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-710s1c1
Sequence:CCGGGCATGAAGTAACGGGCTGGGTCTCGAGACCCAGCCCGTTACTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-392s1c1
Sequence:CCGGCGGCAGCAACGGCATCACCTACTCGAGTAGGTGATGCCGTTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008048.1-602s1c1
Sequence:CCGGCCTCATCTGGAACAAGGTAAACTCGAGTTTACCTTGTTCCAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001553
VALIDATED
IGFBP7 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001553.1-812s1c1
Sequence:CCGGACAGTGGTTGATGCCTTACATCTCGAGATGTAAGGCATCAACCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-721s1c1
Sequence:CCGGGCTGGTATCTCCTCTAAGTAACTCGAGTTACTTAGAGGAGATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-959s1c1
Sequence:CCGGCAATCCACTAACACTTTAGTTCTCGAGAACTAAAGTGTTAGTGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-852s21c1
Sequence:CCGGGTGAAGGTGCCGAGCTATAAACTCGAGTTTATAGCTCGGCACCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-560s21c1
Sequence:CCGGAGCTGTGAGGTCATCGGAATCCTCGAGGATTCCGATGACCTCACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-618s1c2
Sequence:CCGGGTCACTATGGAGTTCAAAGGACTCGAGTCCTTTGAACTCCATAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001553
VALIDATED
IGFBP7 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001553.1-812s1c1
Sequence:CCGGACAGTGGTTGATGCCTTACATCTCGAGATGTAAGGCATCAACCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-721s1c1
Sequence:CCGGGCTGGTATCTCCTCTAAGTAACTCGAGTTACTTAGAGGAGATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-959s1c1
Sequence:CCGGCAATCCACTAACACTTTAGTTCTCGAGAACTAAAGTGTTAGTGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-852s21c1
Sequence:CCGGGTGAAGGTGCCGAGCTATAAACTCGAGTTTATAGCTCGGCACCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-560s21c1
Sequence:CCGGAGCTGTGAGGTCATCGGAATCCTCGAGGATTCCGATGACCTCACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-618s1c2
Sequence:CCGGGTCACTATGGAGTTCAAAGGACTCGAGTCCTTTGAACTCCATAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001553
VALIDATED
IGFBP7 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001553.1-812s1c1
Sequence:CCGGACAGTGGTTGATGCCTTACATCTCGAGATGTAAGGCATCAACCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-721s1c1
Sequence:CCGGGCTGGTATCTCCTCTAAGTAACTCGAGTTACTTAGAGGAGATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-959s1c1
Sequence:CCGGCAATCCACTAACACTTTAGTTCTCGAGAACTAAAGTGTTAGTGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-852s21c1
Sequence:CCGGGTGAAGGTGCCGAGCTATAAACTCGAGTTTATAGCTCGGCACCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001553.1-560s21c1
Sequence:CCGGAGCTGTGAGGTCATCGGAATCCTCGAGGATTCCGATGACCTCACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001553.1-618s1c2
Sequence:CCGGGTCACTATGGAGTTCAAAGGACTCGAGTCCTTTGAACTCCATAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)