EMAIL THIS PAGE TO A FRIEND

IGFBPL1

insulin-like growth factor binding protein-like 1

44 Gene Product Result for
Synonyms: IGFBP-RP4 IGFBPRP4 bA113O24.1
UniProtKB ID: Q8WX77
Gene ID:
Mouse(75426) insulin-like growth factor binding protein-like 1
Rat(366366) insulin-like growth factor binding protein-like 1
sheep(101105881) insulin-like growth factor binding protein-like 1
domestic guinea pig(100734720) insulin-like growth factor binding protein-like 1
naked mole-rat(101700885) insulin-like growth factor binding protein-like 1
dog(481621) insulin-like growth factor binding protein-like 1
cow(616886) insulin-like growth factor binding protein-like 1
domestic cat(101091055) insulin-like growth factor binding protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007563 Rosetta Predictions human pricing
NM_001108972 Rosetta Predictions rat pricing
NM_018741 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305346 predicted 855
2 SASI_Hs01_00063293 predicted 843
3 SASI_Hs01_00063294 predicted 787
4 SASI_Hs02_00305347 predicted 786
5 SASI_Hs01_00063295 predicted 784
6 SASI_Hs02_00305348 predicted 847
7 SASI_Hs01_00063298 predicted 805
8 SASI_Hs01_00063299 predicted 821
9 SASI_Hs01_00063300 predicted 737
10 SASI_Hs01_00063301 predicted 791
11 SASI_Hs01_00063296 predicted 866
12 SASI_Hs01_00063297 predicted 866
13 SASI_Hs01_00063302 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243904 predicted 923
2 SASI_Rn02_00243905 predicted 1029
3 SASI_Rn02_00243906 predicted 651
4 SASI_Rn02_00243907 predicted 887
5 SASI_Rn02_00243908 predicted 638
6 SASI_Rn02_00243909 predicted 1013
7 SASI_Rn02_00243910 predicted 822
8 SASI_Rn02_00243911 predicted 957
9 SASI_Rn02_00243912 predicted 766
10 SASI_Rn02_00243913 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021439 predicted 1320
2 SASI_Mm01_00021440 predicted 1209
3 SASI_Mm01_00021441 predicted 499
4 SASI_Mm01_00021442 predicted 674
5 SASI_Mm01_00021443 predicted 1199
6 SASI_Mm01_00021444 predicted 1214
7 SASI_Mm01_00021445 predicted 1211
8 SASI_Mm01_00021446 predicted 486
9 SASI_Mm01_00021447 predicted 348
10 SASI_Mm01_00021448 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007563
VALIDATED
IGFBPL1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-505s21c1
Sequence:CCGGCCCGAAGTGTTCACAACGTCACTCGAGTGACGTTGTGAACACTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-480s21c1
Sequence:CCGGTTCGCTCCTGTGGTCGTCGTTCTCGAGAACGACGACCACAGGAGCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-787s21c1
Sequence:CCGGACAGCACAGTGACGGTTCTAGCTCGAGCTAGAACCGTCACTGTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007563.1-882s21c1
Sequence:CCGGATTGATCATGGGATGATGGAACTCGAGTTCCATCATCCCATGATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007563.1-914s1c1
Sequence:CCGGCGGATCTTTGTGCTTCATGAACTCGAGTTCATGAAGCACAAAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-799s1c1
Sequence:CCGGCGGTTCTAGATCTGAGTAAATCTCGAGATTTACTCAGATCTAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-746s1c1
Sequence:CCGGCCAGTGCCATGCAGCCAACATCTCGAGATGTTGGCTGCATGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-572s1c1
Sequence:CCGGCCCAGTCATCACGTGGAGAAACTCGAGTTTCTCCACGTGATGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-645s1c1
Sequence:CCGGCATGTCAATATAGCTGTCCAACTCGAGTTGGACAGCTATATTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007563
VALIDATED
IGFBPL1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-505s21c1
Sequence:CCGGCCCGAAGTGTTCACAACGTCACTCGAGTGACGTTGTGAACACTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-480s21c1
Sequence:CCGGTTCGCTCCTGTGGTCGTCGTTCTCGAGAACGACGACCACAGGAGCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-787s21c1
Sequence:CCGGACAGCACAGTGACGGTTCTAGCTCGAGCTAGAACCGTCACTGTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007563.1-882s21c1
Sequence:CCGGATTGATCATGGGATGATGGAACTCGAGTTCCATCATCCCATGATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007563.1-914s1c1
Sequence:CCGGCGGATCTTTGTGCTTCATGAACTCGAGTTCATGAAGCACAAAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-799s1c1
Sequence:CCGGCGGTTCTAGATCTGAGTAAATCTCGAGATTTACTCAGATCTAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-746s1c1
Sequence:CCGGCCAGTGCCATGCAGCCAACATCTCGAGATGTTGGCTGCATGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-572s1c1
Sequence:CCGGCCCAGTCATCACGTGGAGAAACTCGAGTTTCTCCACGTGATGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-645s1c1
Sequence:CCGGCATGTCAATATAGCTGTCCAACTCGAGTTGGACAGCTATATTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007563
VALIDATED
IGFBPL1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-505s21c1
Sequence:CCGGCCCGAAGTGTTCACAACGTCACTCGAGTGACGTTGTGAACACTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-480s21c1
Sequence:CCGGTTCGCTCCTGTGGTCGTCGTTCTCGAGAACGACGACCACAGGAGCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007563.1-787s21c1
Sequence:CCGGACAGCACAGTGACGGTTCTAGCTCGAGCTAGAACCGTCACTGTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007563.1-882s21c1
Sequence:CCGGATTGATCATGGGATGATGGAACTCGAGTTCCATCATCCCATGATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007563.1-914s1c1
Sequence:CCGGCGGATCTTTGTGCTTCATGAACTCGAGTTCATGAAGCACAAAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-799s1c1
Sequence:CCGGCGGTTCTAGATCTGAGTAAATCTCGAGATTTACTCAGATCTAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001007563.1-746s1c1
Sequence:CCGGCCAGTGCCATGCAGCCAACATCTCGAGATGTTGGCTGCATGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-572s1c1
Sequence:CCGGCCCAGTCATCACGTGGAGAAACTCGAGTTTCTCCACGTGATGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007563.1-645s1c1
Sequence:CCGGCATGTCAATATAGCTGTCCAACTCGAGTTGGACAGCTATATTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018741
IGFBPL1 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor binding protein-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-567s21c1
Sequence:CCGGTCACCTGGAAGAAGGTCAAGCCTCGAGGCTTGACCTTCTTCCAGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018741.2-1218s21c1
Sequence:CCGGCTCTGATTTGGTGCGTGTTATCTCGAGATAACACGCACCAAATCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-509s21c1
Sequence:CCGGGTCACTGGGACTCAAGTATTCCTCGAGGAATACTTGAGTCCCAGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-788s21c1
Sequence:CCGGGTCCTCGATCTGAACAGATACCTCGAGGTATCTGTTCAGATCGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-623s21c1
Sequence:CCGGCCCGGAGACCATGTCAATATACTCGAGTATATTGACATGGTCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-491s1c1
Sequence:CCGGCACAATGTCACTGGGACTCAACTCGAGTTGAGTCCCAGTGACATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-507s1c1
Sequence:CCGGCTCAAGTATTCCTTTCCTGTGCTCGAGCACAGGAAAGGAATACTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018741.1-2428s1c1
Sequence:CCGGGCCTCTGTGTCCTCAAGTAAACTCGAGTTTACTTGAGGACACAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018741
IGFBPL1 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor binding protein-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-567s21c1
Sequence:CCGGTCACCTGGAAGAAGGTCAAGCCTCGAGGCTTGACCTTCTTCCAGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018741.2-1218s21c1
Sequence:CCGGCTCTGATTTGGTGCGTGTTATCTCGAGATAACACGCACCAAATCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-509s21c1
Sequence:CCGGGTCACTGGGACTCAAGTATTCCTCGAGGAATACTTGAGTCCCAGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-788s21c1
Sequence:CCGGGTCCTCGATCTGAACAGATACCTCGAGGTATCTGTTCAGATCGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-623s21c1
Sequence:CCGGCCCGGAGACCATGTCAATATACTCGAGTATATTGACATGGTCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-491s1c1
Sequence:CCGGCACAATGTCACTGGGACTCAACTCGAGTTGAGTCCCAGTGACATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-507s1c1
Sequence:CCGGCTCAAGTATTCCTTTCCTGTGCTCGAGCACAGGAAAGGAATACTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018741.1-2428s1c1
Sequence:CCGGGCCTCTGTGTCCTCAAGTAAACTCGAGTTTACTTGAGGACACAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018741
IGFBPL1 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor binding protein-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-567s21c1
Sequence:CCGGTCACCTGGAAGAAGGTCAAGCCTCGAGGCTTGACCTTCTTCCAGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018741.2-1218s21c1
Sequence:CCGGCTCTGATTTGGTGCGTGTTATCTCGAGATAACACGCACCAAATCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-509s21c1
Sequence:CCGGGTCACTGGGACTCAAGTATTCCTCGAGGAATACTTGAGTCCCAGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-788s21c1
Sequence:CCGGGTCCTCGATCTGAACAGATACCTCGAGGTATCTGTTCAGATCGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018741.2-623s21c1
Sequence:CCGGCCCGGAGACCATGTCAATATACTCGAGTATATTGACATGGTCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-491s1c1
Sequence:CCGGCACAATGTCACTGGGACTCAACTCGAGTTGAGTCCCAGTGACATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179935    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018741.1-507s1c1
Sequence:CCGGCTCAAGTATTCCTTTCCTGTGCTCGAGCACAGGAAAGGAATACTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018741.1-2428s1c1
Sequence:CCGGGCCTCTGTGTCCTCAAGTAAACTCGAGTTTACTTGAGGACACAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)