EMAIL THIS PAGE TO A FRIEND

IGFL1

IGF-like family member 1

56 Gene Product Result for
Synonyms: APRG644 UNQ644
Species: Human IGFL1(374918), domestic guinea pig Igfl1(101788798)
UniProtKB ID: Q6UW32
Gene ID:
Human(374918) Summary: IGFL1 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]
domestic guinea pig(101788798) IGF-like family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198541 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198541 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019002 predicted 236
2 SASI_Hs01_00019003 predicted 468
3 SASI_Hs01_00019004 predicted 466
4 SASI_Hs01_00019005 predicted 327
5 SASI_Hs01_00019006 predicted 230
6 SASI_Hs01_00019007 predicted 223
7 SASI_Hs02_00372147 predicted 426
8 SASI_Hs01_00019008 predicted 219
9 SASI_Hs01_00019009 predicted 404
10 SASI_Hs01_00019010 predicted 344
11 SASI_Hs01_00019011 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198541
IGFL1 MISSION shRNA Bacterial Glycerol Stock
IGF-like family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-242s1c1
Sequence:CCGGCTTCAGAGTCTGCTTTGAGCACTCGAGTGCTCAAAGCAGACTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-293s1c1
Sequence:CCGGGATAAACCAGAACTGCGACTCCTCGAGGAGTCGCAGTTCTGGTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198541.1-462s1c1
Sequence:CCGGGCCAGAGAAACACACACTCAACTCGAGTTGAGTGTGTGTTTCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-110s1c1
Sequence:CCGGCATGACTCCTTACCTGATGCTCTCGAGAGCATCAGGTAAGGAGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-177s1c1
Sequence:CCGGCAGCACTGTTGCTATGATGATCTCGAGATCATCATAGCAACAGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-287s1c1
Sequence:CCGGGAAGCTGATAAACCAGAACTGCTCGAGCAGTTCTGGTTTATCAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-277s1c1
Sequence:CCGGCCTTCATGGTGAAGCTGATAACTCGAGTTATCAGCTTCACCATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-281s1c1
Sequence:CCGGCATGGTGAAGCTGATAAACCACTCGAGTGGTTTATCAGCTTCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-275s1c1
Sequence:CCGGGACCTTCATGGTGAAGCTGATCTCGAGATCAGCTTCACCATGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-232s1c1
Sequence:CCGGGAAACTGCACCTTCAGAGTCTCTCGAGAGACTCTGAAGGTGCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-176s1c1
Sequence:CCGGGCAGCACTGTTGCTATGATGACTCGAGTCATCATAGCAACAGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198541
IGFL1 MISSION shRNA shRNA Plasmid DNA
IGF-like family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-242s1c1
Sequence:CCGGCTTCAGAGTCTGCTTTGAGCACTCGAGTGCTCAAAGCAGACTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-293s1c1
Sequence:CCGGGATAAACCAGAACTGCGACTCCTCGAGGAGTCGCAGTTCTGGTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198541.1-462s1c1
Sequence:CCGGGCCAGAGAAACACACACTCAACTCGAGTTGAGTGTGTGTTTCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-110s1c1
Sequence:CCGGCATGACTCCTTACCTGATGCTCTCGAGAGCATCAGGTAAGGAGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-177s1c1
Sequence:CCGGCAGCACTGTTGCTATGATGATCTCGAGATCATCATAGCAACAGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-287s1c1
Sequence:CCGGGAAGCTGATAAACCAGAACTGCTCGAGCAGTTCTGGTTTATCAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-277s1c1
Sequence:CCGGCCTTCATGGTGAAGCTGATAACTCGAGTTATCAGCTTCACCATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-281s1c1
Sequence:CCGGCATGGTGAAGCTGATAAACCACTCGAGTGGTTTATCAGCTTCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-275s1c1
Sequence:CCGGGACCTTCATGGTGAAGCTGATCTCGAGATCAGCTTCACCATGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-232s1c1
Sequence:CCGGGAAACTGCACCTTCAGAGTCTCTCGAGAGACTCTGAAGGTGCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-176s1c1
Sequence:CCGGGCAGCACTGTTGCTATGATGACTCGAGTCATCATAGCAACAGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198541
IGFL1 MISSION shRNA Lentiviral Transduction Particles
IGF-like family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-242s1c1
Sequence:CCGGCTTCAGAGTCTGCTTTGAGCACTCGAGTGCTCAAAGCAGACTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-293s1c1
Sequence:CCGGGATAAACCAGAACTGCGACTCCTCGAGGAGTCGCAGTTCTGGTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198541.1-462s1c1
Sequence:CCGGGCCAGAGAAACACACACTCAACTCGAGTTGAGTGTGTGTTTCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-110s1c1
Sequence:CCGGCATGACTCCTTACCTGATGCTCTCGAGAGCATCAGGTAAGGAGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-177s1c1
Sequence:CCGGCAGCACTGTTGCTATGATGATCTCGAGATCATCATAGCAACAGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-287s1c1
Sequence:CCGGGAAGCTGATAAACCAGAACTGCTCGAGCAGTTCTGGTTTATCAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-277s1c1
Sequence:CCGGCCTTCATGGTGAAGCTGATAACTCGAGTTATCAGCTTCACCATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-281s1c1
Sequence:CCGGCATGGTGAAGCTGATAAACCACTCGAGTGGTTTATCAGCTTCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-275s1c1
Sequence:CCGGGACCTTCATGGTGAAGCTGATCTCGAGATCAGCTTCACCATGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-232s1c1
Sequence:CCGGGAAACTGCACCTTCAGAGTCTCTCGAGAGACTCTGAAGGTGCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198541.1-176s1c1
Sequence:CCGGGCAGCACTGTTGCTATGATGACTCGAGTCATCATAGCAACAGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)