EMAIL THIS PAGE TO A FRIEND

IGFL2

IGF-like family member 2

15 Gene Product Result for
Synonyms: UNQ645 VPRI645
Species: Human IGFL2(147920)
UniProtKB ID: Q6UWQ7, E9PAV1, Q6B9Z3
Gene ID:
Human(147920) Summary: IGFL2 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059137 Anti-IGFL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_085932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085932 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002915 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245392 predicted 465
2 SASI_Hs01_00245393 predicted 428
3 SASI_Hs01_00245394 predicted 465
4 SASI_Hs01_00245396 predicted 566
5 SASI_Hs01_00245397 predicted 390
6 SASI_Hs01_00245399 predicted 437
7 SASI_Hs01_00245400 predicted 549
8 SASI_Hs01_00245401 predicted 491
9 SASI_Hs02_00304264 predicted 427
10 SASI_Hs01_00245398 predicted 354
11 SASI_Hs01_00245395 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085932
IGFL2 MISSION shRNA Bacterial Glycerol Stock
IGF-like family member 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-475s1c1
Sequence:CCGGCTGAAGGTTCAGGGTGTGAATCTCGAGATTCACACCCTGAACCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-606s1c1
Sequence:CCGGGCTAAGGTAATATGTGTACCACTCGAGTGGTACACATATTACCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-595s1c1
Sequence:CCGGCAGAAACATAGGCTAAGGTAACTCGAGTTACCTTAGCCTATGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-426s1c1
Sequence:CCGGGCTCTGCTGTCTTGATTCCTTCTCGAGAAGGAATCAAGACAGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-350s1c1
Sequence:CCGGGTTACAATGACGCCATCGTGTCTCGAGACACGATGGCGTCATTGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-515s1c1
Sequence:CCGGCCATCTCCAGTAAATGTGAAACTCGAGTTTCACATTTACTGGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-521s1c1
Sequence:CCGGCCAGTAAATGTGAAAGCAGAACTCGAGTTCTGCTTTCACATTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-584s1c1
Sequence:CCGGCTAAGGCATCTCAGAAACATACTCGAGTATGTTTCTGAGATGCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-444s1c1
Sequence:CCGGCTTTGGCCTCACAAACGATTTCTCGAGAAATCGTTTGTGAGGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-217s1c1
Sequence:CCGGCCTGCTTATGTGTCAGTCTGTCTCGAGACAGACTGACACATAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-436s1c1
Sequence:CCGGCTTGATTCCTTTGGCCTCACACTCGAGTGTGAGGCCAAAGGAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-246s1c1
Sequence:CCGGCTTGTGTCCAAGGGAAGTCATCTCGAGATGACTTCCCTTGGACACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085932
IGFL2 MISSION shRNA shRNA Plasmid DNA
IGF-like family member 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-475s1c1
Sequence:CCGGCTGAAGGTTCAGGGTGTGAATCTCGAGATTCACACCCTGAACCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-606s1c1
Sequence:CCGGGCTAAGGTAATATGTGTACCACTCGAGTGGTACACATATTACCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-595s1c1
Sequence:CCGGCAGAAACATAGGCTAAGGTAACTCGAGTTACCTTAGCCTATGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-426s1c1
Sequence:CCGGGCTCTGCTGTCTTGATTCCTTCTCGAGAAGGAATCAAGACAGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-350s1c1
Sequence:CCGGGTTACAATGACGCCATCGTGTCTCGAGACACGATGGCGTCATTGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-515s1c1
Sequence:CCGGCCATCTCCAGTAAATGTGAAACTCGAGTTTCACATTTACTGGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-521s1c1
Sequence:CCGGCCAGTAAATGTGAAAGCAGAACTCGAGTTCTGCTTTCACATTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-584s1c1
Sequence:CCGGCTAAGGCATCTCAGAAACATACTCGAGTATGTTTCTGAGATGCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-444s1c1
Sequence:CCGGCTTTGGCCTCACAAACGATTTCTCGAGAAATCGTTTGTGAGGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-217s1c1
Sequence:CCGGCCTGCTTATGTGTCAGTCTGTCTCGAGACAGACTGACACATAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-436s1c1
Sequence:CCGGCTTGATTCCTTTGGCCTCACACTCGAGTGTGAGGCCAAAGGAATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-246s1c1
Sequence:CCGGCTTGTGTCCAAGGGAAGTCATCTCGAGATGACTTCCCTTGGACACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085932
IGFL2 MISSION shRNA Lentiviral Transduction Particles
IGF-like family member 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-475s1c1
Sequence:CCGGCTGAAGGTTCAGGGTGTGAATCTCGAGATTCACACCCTGAACCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-606s1c1
Sequence:CCGGGCTAAGGTAATATGTGTACCACTCGAGTGGTACACATATTACCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-595s1c1
Sequence:CCGGCAGAAACATAGGCTAAGGTAACTCGAGTTACCTTAGCCTATGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-426s1c1
Sequence:CCGGGCTCTGCTGTCTTGATTCCTTCTCGAGAAGGAATCAAGACAGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-350s1c1
Sequence:CCGGGTTACAATGACGCCATCGTGTCTCGAGACACGATGGCGTCATTGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-515s1c1
Sequence:CCGGCCATCTCCAGTAAATGTGAAACTCGAGTTTCACATTTACTGGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-521s1c1
Sequence:CCGGCCAGTAAATGTGAAAGCAGAACTCGAGTTCTGCTTTCACATTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_085932.7-584s1c1
Sequence:CCGGCTAAGGCATCTCAGAAACATACTCGAGTATGTTTCTGAGATGCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-444s1c1
Sequence:CCGGCTTTGGCCTCACAAACGATTTCTCGAGAAATCGTTTGTGAGGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-217s1c1
Sequence:CCGGCCTGCTTATGTGTCAGTCTGTCTCGAGACAGACTGACACATAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-436s1c1
Sequence:CCGGCTTGATTCCTTTGGCCTCACACTCGAGTGTGAGGCCAAAGGAATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085932.7-246s1c1
Sequence:CCGGCTTGTGTCCAAGGGAAGTCATCTCGAGATGACTTCCCTTGGACACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)