EMAIL THIS PAGE TO A FRIEND

IGFL3

IGF-like family member 3

43 Gene Product Result for
Synonyms: UNQ483
UniProtKB ID: Q6UXB1
Gene ID:
Human(388555) Summary: IGFL3 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]
Mouse(232925) IGF-like family member 3
Rat(361516) IGF-like family member 3
dog(612207) IGF-like family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136361 MISSION® esiRNA esiRNA human IGFL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207393 Rosetta Predictions human pricing
NM_001108474 Rosetta Predictions rat pricing
NM_001003393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152933 predicted 332
2 SASI_Hs01_00152934 predicted 164
3 SASI_Hs01_00152935 predicted 180
4 SASI_Hs01_00152936 predicted 347
5 SASI_Hs01_00152937 predicted 149
6 SASI_Hs01_00152938 predicted 331
7 SASI_Hs01_00152939 predicted 177
8 SASI_Hs01_00152940 predicted 197
9 SASI_Hs01_00152941 predicted 47
10 SASI_Hs01_00152942 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238999 predicted 716
2 SASI_Rn02_00239000 predicted 755
3 SASI_Rn02_00239001 predicted 756
4 SASI_Rn02_00239002 predicted 478
5 SASI_Rn02_00239003 predicted 463
6 SASI_Rn02_00239004 predicted 455
7 SASI_Rn02_00239005 predicted 289
8 SASI_Rn02_00239006 predicted 678
9 SASI_Rn02_00239007 predicted 484
10 SASI_Rn02_00239008 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117531 predicted 236
2 SASI_Mm01_00117532 predicted 240
3 SASI_Mm02_00286315 predicted 293
4 SASI_Mm01_00117534 predicted 210
5 SASI_Mm01_00117536 predicted 204
6 SASI_Mm01_00117537 predicted 329
7 SASI_Mm02_00286316 predicted 322
8 SASI_Mm01_00117538 predicted 324
9 SASI_Mm01_00117539 predicted 201
10 SASI_Mm02_00286317 predicted 245
11 SASI_Mm01_00117533 predicted 213
12 SASI_Mm01_00117535 predicted 301
13 SASI_Mm01_00117540 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207393
IGFL3 MISSION shRNA Bacterial Glycerol Stock
IGF-like family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-151s1c1
Sequence:CCGGGTGTGGGAACAAGATCTACAACTCGAGTTGTAGATCTTGTTCCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-186s1c1
Sequence:CCGGGCTGTTATGATGATGCCATCTCTCGAGAGATGGCATCATCATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-194s1c1
Sequence:CCGGGATGATGCCATCTTATCCTTACTCGAGTAAGGATAAGATGGCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-184s1c1
Sequence:CCGGGTGCTGTTATGATGATGCCATCTCGAGATGGCATCATCATAACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-313s1c1
Sequence:CCGGGTTGAGGGTTCTGGGTATGAACTCGAGTTCATACCCAGAACCCTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-485s1c1
Sequence:CCGGCGGAGAGAAGCAACTTGACTTCTCGAGAAGTCAAGTTGCTTCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-512s1c1
Sequence:CCGGGATGGCTCAATGACATAGCTTCTCGAGAAGCTATGTCATTGAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-494s1c1
Sequence:CCGGGCAACTTGACTTCAGAGGGATCTCGAGATCCCTCTGAAGTCAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-305s1c1
Sequence:CCGGCTTGTGAAGTTGAGGGTTCTGCTCGAGCAGAACCCTCAACTTCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207393
IGFL3 MISSION shRNA shRNA Plasmid DNA
IGF-like family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-151s1c1
Sequence:CCGGGTGTGGGAACAAGATCTACAACTCGAGTTGTAGATCTTGTTCCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-186s1c1
Sequence:CCGGGCTGTTATGATGATGCCATCTCTCGAGAGATGGCATCATCATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-194s1c1
Sequence:CCGGGATGATGCCATCTTATCCTTACTCGAGTAAGGATAAGATGGCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-184s1c1
Sequence:CCGGGTGCTGTTATGATGATGCCATCTCGAGATGGCATCATCATAACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-313s1c1
Sequence:CCGGGTTGAGGGTTCTGGGTATGAACTCGAGTTCATACCCAGAACCCTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-485s1c1
Sequence:CCGGCGGAGAGAAGCAACTTGACTTCTCGAGAAGTCAAGTTGCTTCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-512s1c1
Sequence:CCGGGATGGCTCAATGACATAGCTTCTCGAGAAGCTATGTCATTGAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-494s1c1
Sequence:CCGGGCAACTTGACTTCAGAGGGATCTCGAGATCCCTCTGAAGTCAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-305s1c1
Sequence:CCGGCTTGTGAAGTTGAGGGTTCTGCTCGAGCAGAACCCTCAACTTCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207393
IGFL3 MISSION shRNA Lentiviral Transduction Particles
IGF-like family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-151s1c1
Sequence:CCGGGTGTGGGAACAAGATCTACAACTCGAGTTGTAGATCTTGTTCCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-186s1c1
Sequence:CCGGGCTGTTATGATGATGCCATCTCTCGAGAGATGGCATCATCATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-194s1c1
Sequence:CCGGGATGATGCCATCTTATCCTTACTCGAGTAAGGATAAGATGGCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-184s1c1
Sequence:CCGGGTGCTGTTATGATGATGCCATCTCGAGATGGCATCATCATAACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-313s1c1
Sequence:CCGGGTTGAGGGTTCTGGGTATGAACTCGAGTTCATACCCAGAACCCTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-485s1c1
Sequence:CCGGCGGAGAGAAGCAACTTGACTTCTCGAGAAGTCAAGTTGCTTCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-512s1c1
Sequence:CCGGGATGGCTCAATGACATAGCTTCTCGAGAAGCTATGTCATTGAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207393.1-494s1c1
Sequence:CCGGGCAACTTGACTTCAGAGGGATCTCGAGATCCCTCTGAAGTCAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207393.1-305s1c1
Sequence:CCGGCTTGTGAAGTTGAGGGTTCTGCTCGAGCAGAACCCTCAACTTCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003393
IGFL3 MISSION shRNA Bacterial Glycerol Stock
IGF-like family member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-319s1c1
Sequence:CCGGCTTAAAGTTCATGGAGAGAGACTCGAGTCTCTCTCCATGAACTTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-210s1c1
Sequence:CCGGCCTGCCCTTTAAGCGGATTAACTCGAGTTAATCCGCTTAAAGGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-61s1c1
Sequence:CCGGCTTATTGAAGTACTCCTGTTTCTCGAGAAACAGGAGTACTTCAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-403s1c1
Sequence:CCGGGATATTGAAGACAACCAACTTCTCGAGAAGTTGGTTGTCTTCAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-414s1c1
Sequence:CCGGCAACCAACTTTCTCTTAGGAACTCGAGTTCCTAAGAGAAAGTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-313s1c1
Sequence:CCGGGTCAAGCTTAAAGTTCATGGACTCGAGTCCATGAACTTTAAGCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-358s1c1
Sequence:CCGGCCTATCTCCAGGAACTGTAAACTCGAGTTTACAGTTCCTGGAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003393
IGFL3 MISSION shRNA shRNA Plasmid DNA
IGF-like family member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-319s1c1
Sequence:CCGGCTTAAAGTTCATGGAGAGAGACTCGAGTCTCTCTCCATGAACTTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-210s1c1
Sequence:CCGGCCTGCCCTTTAAGCGGATTAACTCGAGTTAATCCGCTTAAAGGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-61s1c1
Sequence:CCGGCTTATTGAAGTACTCCTGTTTCTCGAGAAACAGGAGTACTTCAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-403s1c1
Sequence:CCGGGATATTGAAGACAACCAACTTCTCGAGAAGTTGGTTGTCTTCAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-414s1c1
Sequence:CCGGCAACCAACTTTCTCTTAGGAACTCGAGTTCCTAAGAGAAAGTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-313s1c1
Sequence:CCGGGTCAAGCTTAAAGTTCATGGACTCGAGTCCATGAACTTTAAGCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-358s1c1
Sequence:CCGGCCTATCTCCAGGAACTGTAAACTCGAGTTTACAGTTCCTGGAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003393
IGFL3 MISSION shRNA Lentiviral Transduction Particles
IGF-like family member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-319s1c1
Sequence:CCGGCTTAAAGTTCATGGAGAGAGACTCGAGTCTCTCTCCATGAACTTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-210s1c1
Sequence:CCGGCCTGCCCTTTAAGCGGATTAACTCGAGTTAATCCGCTTAAAGGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-61s1c1
Sequence:CCGGCTTATTGAAGTACTCCTGTTTCTCGAGAAACAGGAGTACTTCAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-403s1c1
Sequence:CCGGGATATTGAAGACAACCAACTTCTCGAGAAGTTGGTTGTCTTCAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-414s1c1
Sequence:CCGGCAACCAACTTTCTCTTAGGAACTCGAGTTCCTAAGAGAAAGTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003393.1-313s1c1
Sequence:CCGGGTCAAGCTTAAAGTTCATGGACTCGAGTCCATGAACTTTAAGCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216722    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003393.1-358s1c1
Sequence:CCGGCCTATCTCCAGGAACTGTAAACTCGAGTTTACAGTTCCTGGAGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)