EMAIL THIS PAGE TO A FRIEND

IGFL4

IGF-like family member 4

17 Gene Product Result for
Species: Human IGFL4(444882)
UniProtKB ID: Q6B9Z1
Gene ID:
Human(444882) Summary: IGFL4 belongs to the insulin-like growth factor (IGF; see MIM 147440) family of signaling molecules that play critical roles in cellular energy metabolism and in growth and development, especially prenatal growth (Emtage et al., 2006 [PubMed 16890402]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047655 Anti-IGFL4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002923 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142421 MISSION® esiRNA esiRNA human IGFL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002923 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119016 predicted 195
2 SASI_Hs01_00119017 predicted 204
3 SASI_Hs01_00119019 predicted 203
4 SASI_Hs01_00119020 predicted 228
5 SASI_Hs01_00119021 predicted 328
6 SASI_Hs01_00119022 predicted 106
7 SASI_Hs01_00119023 predicted 301
8 SASI_Hs01_00119024 predicted 111
9 SASI_Hs01_00119025 predicted 440
10 SASI_Hs02_00304278 predicted 56
11 SASI_Hs01_00119018 predicted 231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002923
IGFL4 MISSION shRNA Bacterial Glycerol Stock
IGF-like family member 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-284s21c1
Sequence:CCGGTGGAGTCTTTGGGCTCTCAGACTCGAGTCTGAGAGCCCAAAGACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-101s1c1
Sequence:CCGGGTTCAAACTCAGAAGGAGTCACTCGAGTGACTCCTTCTGAGTTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-110s1c1
Sequence:CCGGCAGAAGGAGTCACAGATCTTACTCGAGTAAGATCTGTGACTCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-309s1c1
Sequence:CCGGGACAGTTGTGAGGTTCAAGGTCTCGAGACCTTGAACCTCACAACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-303s1c1
Sequence:CCGGGAACCAGACAGTTGTGAGGTTCTCGAGAACCTCACAACTGTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-306s1c1
Sequence:CCGGCCAGACAGTTGTGAGGTTCAACTCGAGTTGAACCTCACAACTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-334s21c1
Sequence:CCGGGGCATGAAGCCAGATTGCAAGCTCGAGCTTGCAATCTGGCTTCATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-378s21c1
Sequence:CCGGTGCCCAGGAATACCACCCAAACTCGAGTTTGGGTGGTATTCCTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-122s1c1
Sequence:CCGGCAGATCTTAGACTGTGGCTATCTCGAGATAGCCACAGTCTAAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-408s1c1
Sequence:CCGGGTCAAGATCTGACCTCATCTACTCGAGTAGATGAGGTCAGATCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-204s1c1
Sequence:CCGGCGGTGTCATCCTAGACTTGAACTCGAGTTCAAGTCTAGGATGACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002923
IGFL4 MISSION shRNA shRNA Plasmid DNA
IGF-like family member 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-284s21c1
Sequence:CCGGTGGAGTCTTTGGGCTCTCAGACTCGAGTCTGAGAGCCCAAAGACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-101s1c1
Sequence:CCGGGTTCAAACTCAGAAGGAGTCACTCGAGTGACTCCTTCTGAGTTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-110s1c1
Sequence:CCGGCAGAAGGAGTCACAGATCTTACTCGAGTAAGATCTGTGACTCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-309s1c1
Sequence:CCGGGACAGTTGTGAGGTTCAAGGTCTCGAGACCTTGAACCTCACAACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-303s1c1
Sequence:CCGGGAACCAGACAGTTGTGAGGTTCTCGAGAACCTCACAACTGTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-306s1c1
Sequence:CCGGCCAGACAGTTGTGAGGTTCAACTCGAGTTGAACCTCACAACTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-334s21c1
Sequence:CCGGGGCATGAAGCCAGATTGCAAGCTCGAGCTTGCAATCTGGCTTCATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-378s21c1
Sequence:CCGGTGCCCAGGAATACCACCCAAACTCGAGTTTGGGTGGTATTCCTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-122s1c1
Sequence:CCGGCAGATCTTAGACTGTGGCTATCTCGAGATAGCCACAGTCTAAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-408s1c1
Sequence:CCGGGTCAAGATCTGACCTCATCTACTCGAGTAGATGAGGTCAGATCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-204s1c1
Sequence:CCGGCGGTGTCATCCTAGACTTGAACTCGAGTTCAAGTCTAGGATGACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002923
IGFL4 MISSION shRNA Lentiviral Transduction Particles
IGF-like family member 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-284s21c1
Sequence:CCGGTGGAGTCTTTGGGCTCTCAGACTCGAGTCTGAGAGCCCAAAGACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-101s1c1
Sequence:CCGGGTTCAAACTCAGAAGGAGTCACTCGAGTGACTCCTTCTGAGTTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-110s1c1
Sequence:CCGGCAGAAGGAGTCACAGATCTTACTCGAGTAAGATCTGTGACTCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-309s1c1
Sequence:CCGGGACAGTTGTGAGGTTCAAGGTCTCGAGACCTTGAACCTCACAACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-303s1c1
Sequence:CCGGGAACCAGACAGTTGTGAGGTTCTCGAGAACCTCACAACTGTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-306s1c1
Sequence:CCGGCCAGACAGTTGTGAGGTTCAACTCGAGTTGAACCTCACAACTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-334s21c1
Sequence:CCGGGGCATGAAGCCAGATTGCAAGCTCGAGCTTGCAATCTGGCTTCATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002923.1-378s21c1
Sequence:CCGGTGCCCAGGAATACCACCCAAACTCGAGTTTGGGTGGTATTCCTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-122s1c1
Sequence:CCGGCAGATCTTAGACTGTGGCTATCTCGAGATAGCCACAGTCTAAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-408s1c1
Sequence:CCGGGTCAAGATCTGACCTCATCTACTCGAGTAGATGAGGTCAGATCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002923.1-204s1c1
Sequence:CCGGCGGTGTCATCCTAGACTTGAACTCGAGTTCAAGTCTAGGATGACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)