EMAIL THIS PAGE TO A FRIEND

IGFLR1

IGF-like family receptor 1

46 Gene Product Result for
Synonyms: TMEM149 U2AF1L4
UniProtKB ID: Q9H665, Q8N5X0
Gene ID:
Mouse(101883) IGF-like family receptor 1
Rat(499126) IGF-like family receptor 1
cow(617594) IGF-like family receptor 1
domestic cat(101098505) IGF-like family receptor 1
dog(484576) IGF-like family receptor 1
sheep(101108594) IGF-like family receptor 1
domestic guinea pig(100735449) IGF-like family receptor 1
naked mole-rat(101699753) IGF-like family receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024660 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024660 Rosetta Predictions human pricing
NM_001134610 Rosetta Predictions rat pricing
NM_145580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043809 predicted 551
2 SASI_Hs01_00043810 predicted 254
3 SASI_Hs01_00043811 predicted 601
4 SASI_Hs01_00043812 predicted 942
5 SASI_Hs01_00043813 predicted 621
6 SASI_Hs01_00043814 predicted 517
7 SASI_Hs01_00043815 predicted 274
8 SASI_Hs01_00043816 predicted 677
9 SASI_Hs01_00043817 predicted 951
10 SASI_Hs01_00043818 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257579 predicted 299
2 SASI_Rn02_00257580 predicted 773
3 SASI_Rn02_00257581 predicted 343
4 SASI_Rn02_00257582 predicted 464
5 SASI_Rn02_00257583 predicted 942
6 SASI_Rn02_00257584 predicted 964
7 SASI_Rn02_00257585 predicted 397
8 SASI_Rn02_00257586 predicted 306
9 SASI_Rn02_00257587 predicted 452
10 SASI_Rn02_00257588 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187011 predicted 423
2 SASI_Mm01_00187008 predicted 735
3 SASI_Mm02_00341114 predicted 490
4 SASI_Mm01_00187009 predicted 740
5 SASI_Mm01_00187010 predicted 299
6 SASI_Mm01_00187012 predicted 755
7 SASI_Mm01_00187013 predicted 410
8 SASI_Mm01_00187014 predicted 906
9 SASI_Mm02_00341115 predicted 228
10 SASI_Mm02_00341116 predicted 662
11 SASI_Mm01_00187015 predicted 711
12 SASI_Mm01_00187016 predicted 721
13 SASI_Mm01_00187017 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145580
VALIDATED
IGFLR1 MISSION shRNA Bacterial Glycerol Stock
IGF-like family receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-911s1c1
Sequence:CCGGCTGATTATGCTATTGGACCCTCTCGAGAGGGTCCAATAGCATAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-501s1c1
Sequence:CCGGCCAAGGATGTCTGTCCTCTTACTCGAGTAAGAGGACAGACATCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-468s1c1
Sequence:CCGGGAACCCACAAGCAGTGTAGAACTCGAGTTCTACACTGCTTGTGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-294s1c1
Sequence:CCGGCATGTCCTGATCACGAGTTTACTCGAGTAAACTCGTGATCAGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-658s1c1
Sequence:CCGGGCTGCTTCTGATATTGGCAGTCTCGAGACTGCCAATATCAGAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145580
VALIDATED
IGFLR1 MISSION shRNA shRNA Plasmid DNA
IGF-like family receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-911s1c1
Sequence:CCGGCTGATTATGCTATTGGACCCTCTCGAGAGGGTCCAATAGCATAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-501s1c1
Sequence:CCGGCCAAGGATGTCTGTCCTCTTACTCGAGTAAGAGGACAGACATCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-468s1c1
Sequence:CCGGGAACCCACAAGCAGTGTAGAACTCGAGTTCTACACTGCTTGTGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-294s1c1
Sequence:CCGGCATGTCCTGATCACGAGTTTACTCGAGTAAACTCGTGATCAGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-658s1c1
Sequence:CCGGGCTGCTTCTGATATTGGCAGTCTCGAGACTGCCAATATCAGAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145580
VALIDATED
IGFLR1 MISSION shRNA Lentiviral Transduction Particles
IGF-like family receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-911s1c1
Sequence:CCGGCTGATTATGCTATTGGACCCTCTCGAGAGGGTCCAATAGCATAATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-501s1c1
Sequence:CCGGCCAAGGATGTCTGTCCTCTTACTCGAGTAAGAGGACAGACATCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-468s1c1
Sequence:CCGGGAACCCACAAGCAGTGTAGAACTCGAGTTCTACACTGCTTGTGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145580.1-294s1c1
Sequence:CCGGCATGTCCTGATCACGAGTTTACTCGAGTAAACTCGTGATCAGGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145580.1-658s1c1
Sequence:CCGGGCTGCTTCTGATATTGGCAGTCTCGAGACTGCCAATATCAGAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024660
IGFLR1 MISSION shRNA Bacterial Glycerol Stock
IGF-like family receptor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-980s21c1
Sequence:CCGGCTGGTCCACCTTTGCCTATTCCTCGAGGAATAGGCAAAGGTGGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-873s21c1
Sequence:CCGGGTGCTGGAAGAGCTGATTGTACTCGAGTACAATCAGCTCTTCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-313s1c1
Sequence:CCGGCCGTTCCGAAAGTGTTCTTCTCTCGAGAGAAGAACACTTTCGGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-624s1c1
Sequence:CCGGGATAGCGATCCTCCTGTTTATCTCGAGATAAACAGGAGGATCGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-187s1c1
Sequence:CCGGGAATACTGGAACCCAGACAACCTCGAGGTTGTCTGGGTTCCAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-281s21c1
Sequence:CCGGACTCAATGACCACGGCGATTTCTCGAGAAATCGCCGTGGTCATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024660
IGFLR1 MISSION shRNA shRNA Plasmid DNA
IGF-like family receptor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-980s21c1
Sequence:CCGGCTGGTCCACCTTTGCCTATTCCTCGAGGAATAGGCAAAGGTGGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-873s21c1
Sequence:CCGGGTGCTGGAAGAGCTGATTGTACTCGAGTACAATCAGCTCTTCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-313s1c1
Sequence:CCGGCCGTTCCGAAAGTGTTCTTCTCTCGAGAGAAGAACACTTTCGGAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-624s1c1
Sequence:CCGGGATAGCGATCCTCCTGTTTATCTCGAGATAAACAGGAGGATCGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-187s1c1
Sequence:CCGGGAATACTGGAACCCAGACAACCTCGAGGTTGTCTGGGTTCCAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-281s21c1
Sequence:CCGGACTCAATGACCACGGCGATTTCTCGAGAAATCGCCGTGGTCATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024660
IGFLR1 MISSION shRNA Lentiviral Transduction Particles
IGF-like family receptor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-980s21c1
Sequence:CCGGCTGGTCCACCTTTGCCTATTCCTCGAGGAATAGGCAAAGGTGGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-873s21c1
Sequence:CCGGGTGCTGGAAGAGCTGATTGTACTCGAGTACAATCAGCTCTTCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-313s1c1
Sequence:CCGGCCGTTCCGAAAGTGTTCTTCTCTCGAGAGAAGAACACTTTCGGAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-624s1c1
Sequence:CCGGGATAGCGATCCTCCTGTTTATCTCGAGATAAACAGGAGGATCGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024660.1-187s1c1
Sequence:CCGGGAATACTGGAACCCAGACAACCTCGAGGTTGTCTGGGTTCCAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024660.2-281s21c1
Sequence:CCGGACTCAATGACCACGGCGATTTCTCGAGAAATCGCCGTGGTCATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)