EMAIL THIS PAGE TO A FRIEND

IGFN1

immunoglobulin-like and fibronectin type III domain containing 1

96 Gene Product Result for
Synonyms: EEF1A2BP1
UniProtKB ID: Q86VF2, F8WAI1, Q9NT72
Gene ID:
Mouse(226438) immunoglobulin-like and fibronectin type III domain containing 1
Rat(304823) immunoglobulin-like and fibronectin type III domain containing 1
domestic guinea pig(100726408) immunoglobulin-like and fibronectin type III domain containing 1
naked mole-rat(101714345) immunoglobulin-like and fibronectin type III domain containing 1
sheep(101109031) immunoglobulin-like and fibronectin type III domain containing 1
chicken(771410) immunoglobulin-like and fibronectin type III domain containing 1
cow(100337233) immunoglobulin-like and fibronectin type III domain containing 1
domestic cat(101099100) immunoglobulin-like and fibronectin type III domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178275 Rosetta Predictions human pricing
XM_001063557 Rosetta Predictions rat pricing
XM_222667 Rosetta Predictions rat pricing
XM_001478252 Rosetta Predictions mouse pricing
XM_001478294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163047 predicted 2950
2 SASI_Hs01_00163048 predicted 1476
3 SASI_Hs01_00163049 predicted 906
4 SASI_Hs01_00163050 predicted 3047
5 SASI_Hs01_00163051 predicted 1759
6 SASI_Hs01_00163052 predicted 2610
7 SASI_Hs01_00163053 predicted 2720
8 SASI_Hs01_00163054 predicted 2384
9 SASI_Hs01_00163055 predicted 3312
10 SASI_Hs02_00369626 predicted 1116
11 SASI_Hs01_00163046 predicted 2905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307570 predicted 2719
2 SASI_Rn02_00307571 predicted 1084
3 SASI_Rn02_00307572 predicted 3904
4 SASI_Rn02_00307573 predicted 887
5 SASI_Rn02_00307574 predicted 1493
6 SASI_Rn02_00307575 predicted 1522
7 SASI_Rn02_00307576 predicted 3530
8 SASI_Rn02_00307577 predicted 1895
9 SASI_Rn02_00307578 predicted 1896
10 SASI_Rn02_00307579 predicted 3850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380835 predicted 2728
2 SASI_Rn02_00380836 predicted 1086
3 SASI_Rn02_00380837 predicted 3907
4 SASI_Rn02_00380838 predicted 893
5 SASI_Rn02_00380839 predicted 1495
6 SASI_Rn02_00380840 predicted 1527
7 SASI_Rn02_00380841 predicted 3530
8 SASI_Rn02_00380842 predicted 1895
9 SASI_Rn02_00380843 predicted 1895
10 SASI_Rn02_00380844 predicted 3851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00401311 predicted 546
2 SASI_Mm02_00401312 predicted 3695
3 SASI_Mm02_00401313 predicted 3850
4 SASI_Mm02_00401314 predicted 3832
5 SASI_Mm02_00401315 predicted 1687
6 SASI_Mm02_00401316 predicted 1134
7 SASI_Mm02_00401317 predicted 1798
8 SASI_Mm02_00401318 predicted 2824
9 SASI_Mm02_00401319 predicted 998
10 SASI_Mm02_00401320 predicted 2917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00401620 predicted 2308
2 SASI_Mm02_00401621 predicted 2884
3 SASI_Mm02_00401622 predicted 2224
4 SASI_Mm02_00401623 predicted 2368
5 SASI_Mm02_00401624 predicted 2870
6 SASI_Mm02_00401625 predicted 2399
7 SASI_Mm02_00401626 predicted 2867
8 SASI_Mm02_00401627 predicted 2907
9 SASI_Mm02_00401628 predicted 2425
10 SASI_Mm02_00401629 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164586
IGFN1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like and fibronectin type III domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000359627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4137s21c1
Sequence:CCGGCAGGGAGCAAGGCAGATTATACTCGAGTATAATCTGCCTTGCTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4918s21c1
Sequence:CCGGAGTGAATGAAGCAGGTTATAGCTCGAGCTATAACCTGCTTCATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-3976s21c1
Sequence:CCGGAGTGGATAAGGAAGGTTATAACTCGAGTTATAACCTTCCTTATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4810s21c1
Sequence:CCGGAGTGAATAAGGCAGGTTATAGCTCGAGCTATAACCTGCCTTATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164586
IGFN1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like and fibronectin type III domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000359627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4137s21c1
Sequence:CCGGCAGGGAGCAAGGCAGATTATACTCGAGTATAATCTGCCTTGCTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4918s21c1
Sequence:CCGGAGTGAATGAAGCAGGTTATAGCTCGAGCTATAACCTGCTTCATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-3976s21c1
Sequence:CCGGAGTGGATAAGGAAGGTTATAACTCGAGTTATAACCTTCCTTATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4810s21c1
Sequence:CCGGAGTGAATAAGGCAGGTTATAGCTCGAGCTATAACCTGCCTTATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164586
IGFN1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like and fibronectin type III domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000359627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4137s21c1
Sequence:CCGGCAGGGAGCAAGGCAGATTATACTCGAGTATAATCTGCCTTGCTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4918s21c1
Sequence:CCGGAGTGAATGAAGCAGGTTATAGCTCGAGCTATAACCTGCTTCATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-3976s21c1
Sequence:CCGGAGTGGATAAGGAAGGTTATAACTCGAGTTATAACCTTCCTTATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164586.1-4810s21c1
Sequence:CCGGAGTGAATAAGGCAGGTTATAGCTCGAGCTATAACCTGCCTTATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178275
IGFN1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like and fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1118s1c1
Sequence:CCGGGATGGAGTCATCTTTAAGCAACTCGAGTTGCTTAAAGATGACTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-925s1c1
Sequence:CCGGGAGTTCCACATCCAGATACAACTCGAGTTGTATCTGGATGTGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1312s1c1
Sequence:CCGGGAAGCCGGTGATAGTGAAGATCTCGAGATCTTCACTATCACCGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178275.3-3584s1c1
Sequence:CCGGGCTCCAAGCTAAGTCACTCAACTCGAGTTGAGTGACTTAGCTTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-3347s1c1
Sequence:CCGGGCCACCCTCATTGTCATAGAACTCGAGTTCTATGACAATGAGGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1537s1c1
Sequence:CCGGGCAAGTCATAGACAAGCCTGACTCGAGTCAGGCTTGTCTATGACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-812s1c1
Sequence:CCGGGAGGAGATGCTGAATGAAGATCTCGAGATCTTCATTCAGCATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178275
IGFN1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like and fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1118s1c1
Sequence:CCGGGATGGAGTCATCTTTAAGCAACTCGAGTTGCTTAAAGATGACTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-925s1c1
Sequence:CCGGGAGTTCCACATCCAGATACAACTCGAGTTGTATCTGGATGTGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1312s1c1
Sequence:CCGGGAAGCCGGTGATAGTGAAGATCTCGAGATCTTCACTATCACCGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178275.3-3584s1c1
Sequence:CCGGGCTCCAAGCTAAGTCACTCAACTCGAGTTGAGTGACTTAGCTTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-3347s1c1
Sequence:CCGGGCCACCCTCATTGTCATAGAACTCGAGTTCTATGACAATGAGGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1537s1c1
Sequence:CCGGGCAAGTCATAGACAAGCCTGACTCGAGTCAGGCTTGTCTATGACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-812s1c1
Sequence:CCGGGAGGAGATGCTGAATGAAGATCTCGAGATCTTCATTCAGCATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178275
IGFN1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like and fibronectin type III domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1118s1c1
Sequence:CCGGGATGGAGTCATCTTTAAGCAACTCGAGTTGCTTAAAGATGACTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-925s1c1
Sequence:CCGGGAGTTCCACATCCAGATACAACTCGAGTTGTATCTGGATGTGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1312s1c1
Sequence:CCGGGAAGCCGGTGATAGTGAAGATCTCGAGATCTTCACTATCACCGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178275.3-3584s1c1
Sequence:CCGGGCTCCAAGCTAAGTCACTCAACTCGAGTTGAGTGACTTAGCTTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-3347s1c1
Sequence:CCGGGCCACCCTCATTGTCATAGAACTCGAGTTCTATGACAATGAGGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-1537s1c1
Sequence:CCGGGCAAGTCATAGACAAGCCTGACTCGAGTCAGGCTTGTCTATGACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178275.3-812s1c1
Sequence:CCGGGAGGAGATGCTGAATGAAGATCTCGAGATCTTCATTCAGCATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177642
IGFN1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin-like and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1124s1c1
Sequence:CCGGGCCTCATGTCACCTGGTTCAACTCGAGTTGAACCAGGTGACATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1294s1c1
Sequence:CCGGCCACCCTCATTGTCACAGAATCTCGAGATTCTGTGACAATGAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-696s1c1
Sequence:CCGGGCACCAGGTTCTATCTACCTACTCGAGTAGGTAGATAGAACCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-992s1c1
Sequence:CCGGCACAGTGAAGTCTCCGACATACTCGAGTATGTCGGAGACTTCACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177642.2-1358s1c1
Sequence:CCGGCCCTACAGCTATGAGATGGATCTCGAGATCCATCTCATAGCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177642
IGFN1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin-like and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1124s1c1
Sequence:CCGGGCCTCATGTCACCTGGTTCAACTCGAGTTGAACCAGGTGACATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1294s1c1
Sequence:CCGGCCACCCTCATTGTCACAGAATCTCGAGATTCTGTGACAATGAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-696s1c1
Sequence:CCGGGCACCAGGTTCTATCTACCTACTCGAGTAGGTAGATAGAACCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-992s1c1
Sequence:CCGGCACAGTGAAGTCTCCGACATACTCGAGTATGTCGGAGACTTCACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177642.2-1358s1c1
Sequence:CCGGCCCTACAGCTATGAGATGGATCTCGAGATCCATCTCATAGCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177642
IGFN1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin-like and fibronectin type III domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1124s1c1
Sequence:CCGGGCCTCATGTCACCTGGTTCAACTCGAGTTGAACCAGGTGACATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-1294s1c1
Sequence:CCGGCCACCCTCATTGTCACAGAATCTCGAGATTCTGTGACAATGAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-696s1c1
Sequence:CCGGGCACCAGGTTCTATCTACCTACTCGAGTAGGTAGATAGAACCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177642.2-992s1c1
Sequence:CCGGCACAGTGAAGTCTCCGACATACTCGAGTATGTCGGAGACTTCACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177642.2-1358s1c1
Sequence:CCGGCCCTACAGCTATGAGATGGATCTCGAGATCCATCTCATAGCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)