EMAIL THIS PAGE TO A FRIEND

IGHG3

immunoglobulin heavy constant gamma 3 (G3m marker)

12 Gene Product Result for
Synonyms: IgG3
UniProtKB ID: P01860, A2NU35
Gene ID:
Mouse(380795) Immunoglobulin heavy constant gamma 3
cow(281852) immunoglobulin heavy constant gamma 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400135 Anti-IGHG3 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224281 MISSION® esiRNA esiRNA targeting human IGHG3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113035 predicted 1232
2 SASI_Mm01_00113036 predicted 1244
3 SASI_Mm01_00113037 predicted 859
4 SASI_Mm01_00113038 predicted 1052
5 SASI_Mm01_00113039 predicted 730
6 SASI_Mm01_00113040 predicted 985
7 SASI_Mm01_00113041 predicted 1303
8 SASI_Mm01_00113042 predicted 719
9 SASI_Mm01_00113043 predicted 1179
10 SASI_Mm01_00113044 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198640
IGHG3 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin heavy constant gamma 3 (G3m marker)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-727s1c1
Sequence:CCGGGACTGAGTTGATCAAGAGAATCTCGAGATTCTCTTGATCAACTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1335s1c1
Sequence:CCGGTCACTGTGGATACAGACAGTTCTCGAGAACTGTCTGTATCCACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198640.1-1472s1c1
Sequence:CCGGCGGGTCTTACAAGACACTGATCTCGAGATCAGTGTCTTGTAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1171s1c1
Sequence:CCGGTGAACAAATGTCCAAGAAGAACTCGAGTTCTTCTTGGACATTTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1168s1c1
Sequence:CCGGTCGTGAACAAATGTCCAAGAACTCGAGTTCTTGGACATTTGTTCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198640
IGHG3 MISSION shRNA shRNA Plasmid DNA
immunoglobulin heavy constant gamma 3 (G3m marker)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-727s1c1
Sequence:CCGGGACTGAGTTGATCAAGAGAATCTCGAGATTCTCTTGATCAACTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1335s1c1
Sequence:CCGGTCACTGTGGATACAGACAGTTCTCGAGAACTGTCTGTATCCACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198640.1-1472s1c1
Sequence:CCGGCGGGTCTTACAAGACACTGATCTCGAGATCAGTGTCTTGTAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1171s1c1
Sequence:CCGGTGAACAAATGTCCAAGAAGAACTCGAGTTCTTCTTGGACATTTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1168s1c1
Sequence:CCGGTCGTGAACAAATGTCCAAGAACTCGAGTTCTTGGACATTTGTTCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198640
IGHG3 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin heavy constant gamma 3 (G3m marker)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-727s1c1
Sequence:CCGGGACTGAGTTGATCAAGAGAATCTCGAGATTCTCTTGATCAACTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1335s1c1
Sequence:CCGGTCACTGTGGATACAGACAGTTCTCGAGAACTGTCTGTATCCACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198640.1-1472s1c1
Sequence:CCGGCGGGTCTTACAAGACACTGATCTCGAGATCAGTGTCTTGTAAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1171s1c1
Sequence:CCGGTGAACAAATGTCCAAGAAGAACTCGAGTTCTTCTTGGACATTTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198640.1-1168s1c1
Sequence:CCGGTCGTGAACAAATGTCCAAGAACTCGAGTTCTTGGACATTTGTTCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)