EMAIL THIS PAGE TO A FRIEND

IGHMBP2

immunoglobulin mu binding protein 2

66 Gene Product Result for
Synonyms: CATF1 HCSA HMN6 SMARD1 SMUBP2 ZFAND7
UniProtKB ID: P38935, A0PJD2, Q00443, Q14177
Gene ID:
Human(3508) Summary: This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
Mouse(20589) immunoglobulin mu binding protein 2
Rat(29532) immunoglobulin mu binding protein 2
sheep(101114988) immunoglobulin mu binding protein 2
domestic guinea pig(100728700) immunoglobulin mu binding protein 2
naked mole-rat(101714751) immunoglobulin mu binding protein 2
Zebrafish(556484) immunoglobulin mu binding protein 2
dog(483686) immunoglobulin mu binding protein 2
cow(618606) immunoglobulin mu binding protein 2
Horse(100060088) immunoglobulin mu binding protein 2
domestic cat(101085832) immunoglobulin mu binding protein 2
chicken(422999) immunoglobulin mu binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055881 MISSION® esiRNA esiRNA human IGHMBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002180 Rosetta Predictions human pricing
NM_031586 Rosetta Predictions rat pricing
NM_009212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101977 predicted 1947
2 SASI_Hs01_00101978 predicted 521
3 SASI_Hs02_00333390 predicted 2300
4 SASI_Hs01_00101979 predicted 494
5 SASI_Hs01_00101981 predicted 2013
6 SASI_Hs01_00101983 predicted 788
7 SASI_Hs02_00333391 predicted 2430
8 SASI_Hs01_00101984 predicted 1439
9 SASI_Hs01_00101985 predicted 1927
10 SASI_Hs01_00101986 predicted 1102
11 SASI_Hs01_00101980 predicted 649
12 SASI_Hs01_00101982 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033015 predicted 1736
2 SASI_Rn02_00264855 predicted 576
3 SASI_Rn01_00033016 predicted 650
4 SASI_Rn01_00033017 predicted 1841
5 SASI_Rn01_00033018 predicted 2133
6 SASI_Rn01_00033019 predicted 2247
7 SASI_Rn01_00033020 predicted 1824
8 SASI_Rn01_00033022 predicted 462
9 SASI_Rn01_00033023 predicted 267
10 SASI_Rn01_00033024 predicted 696
11 SASI_Rn01_00033021 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033008 predicted 2395
2 SASI_Mm02_00315612 predicted 1086
3 SASI_Mm01_00033009 predicted 876
4 SASI_Mm01_00033011 predicted 1075
5 SASI_Mm01_00033012 predicted 492
6 SASI_Mm01_00033013 predicted 494
7 SASI_Mm01_00033014 predicted 1539
8 SASI_Mm01_00033015 predicted 1754
9 SASI_Mm02_00315613 predicted 1840
10 SASI_Mm02_00315614 predicted 1900
11 SASI_Mm01_00033010 predicted 1048
12 SASI_Mm01_00033016 predicted 702
13 SASI_Mm01_00033017 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009212
VALIDATED
IGHMBP2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin mu binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1076s1c1
Sequence:CCGGGAAGTGAAATTAAGCTGCTAACTCGAGTTAGCAGCTTAATTTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-544s1c1
Sequence:CCGGGTCACCTACAAACGCCTGAAACTCGAGTTTCAGGCGTTTGTAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009212.1-385s1c1
Sequence:CCGGGTGGGTCTGTATGATACTAATCTCGAGATTAGTATCATACAGACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1996s1c1
Sequence:CCGGGTGGATTATTTCACAGAGCATCTCGAGATGCTCTGTGAAATAATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-2293s1c1
Sequence:CCGGGAGCACTTTAGGGCTACGATTCTCGAGAATCGTAGCCCTAAAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009212
VALIDATED
IGHMBP2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin mu binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1076s1c1
Sequence:CCGGGAAGTGAAATTAAGCTGCTAACTCGAGTTAGCAGCTTAATTTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-544s1c1
Sequence:CCGGGTCACCTACAAACGCCTGAAACTCGAGTTTCAGGCGTTTGTAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009212.1-385s1c1
Sequence:CCGGGTGGGTCTGTATGATACTAATCTCGAGATTAGTATCATACAGACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1996s1c1
Sequence:CCGGGTGGATTATTTCACAGAGCATCTCGAGATGCTCTGTGAAATAATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-2293s1c1
Sequence:CCGGGAGCACTTTAGGGCTACGATTCTCGAGAATCGTAGCCCTAAAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009212
VALIDATED
IGHMBP2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin mu binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1076s1c1
Sequence:CCGGGAAGTGAAATTAAGCTGCTAACTCGAGTTAGCAGCTTAATTTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-544s1c1
Sequence:CCGGGTCACCTACAAACGCCTGAAACTCGAGTTTCAGGCGTTTGTAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009212.1-385s1c1
Sequence:CCGGGTGGGTCTGTATGATACTAATCTCGAGATTAGTATCATACAGACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-1996s1c1
Sequence:CCGGGTGGATTATTTCACAGAGCATCTCGAGATGCTCTGTGAAATAATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009212.1-2293s1c1
Sequence:CCGGGAGCACTTTAGGGCTACGATTCTCGAGAATCGTAGCCCTAAAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002180
VALIDATED
IGHMBP2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin mu binding protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-915s1c1
Sequence:CCGGGTGCCCAGAATGTTGCAGATACTCGAGTATCTGCAACATTCTGGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-454s21c1
Sequence:CCGGTTTGATGAGTCCCACGATTTCCTCGAGGAAATCGTGGGACTCATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-633s1c1
Sequence:CCGGCCCAGAAAGAAGCGGTTTCATCTCGAGATGAAACCGCTTCTTTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-399s1c1
Sequence:CCGGCCTTTGATGAGTCCCACGATTCTCGAGAATCGTGGGACTCATCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-292s1c1
Sequence:CCGGCAGCTTTACTTCTGGTGATATCTCGAGATATCACCAGAAGTAAAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002180.1-1965s1c1
Sequence:CCGGCCTTTGAGTATCTTGACGATACTCGAGTATCGTCAAGATACTCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-1971s21c1
Sequence:CCGGGAAGACCCTGGTGGAGTATTTCTCGAGAAATACTCCACCAGGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002180.2-3384s21c1
Sequence:CCGGGGTTCCAGTCCCTGGAGAATACTCGAGTATTCTCCAGGGACTGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-767s21c1
Sequence:CCGGCGACTGTGGTTGAGATCATTCCTCGAGGAATGATCTCAACCACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-792s21c1
Sequence:CCGGAGCTGTGAAACAAGGCTTAAACTCGAGTTTAAGCCTTGTTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-561s21c1
Sequence:CCGGTGCTCTAAAGAAGTATCATTCCTCGAGGAATGATACTTCTTTAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002180
VALIDATED
IGHMBP2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin mu binding protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-915s1c1
Sequence:CCGGGTGCCCAGAATGTTGCAGATACTCGAGTATCTGCAACATTCTGGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-454s21c1
Sequence:CCGGTTTGATGAGTCCCACGATTTCCTCGAGGAAATCGTGGGACTCATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-633s1c1
Sequence:CCGGCCCAGAAAGAAGCGGTTTCATCTCGAGATGAAACCGCTTCTTTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-399s1c1
Sequence:CCGGCCTTTGATGAGTCCCACGATTCTCGAGAATCGTGGGACTCATCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-292s1c1
Sequence:CCGGCAGCTTTACTTCTGGTGATATCTCGAGATATCACCAGAAGTAAAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002180.1-1965s1c1
Sequence:CCGGCCTTTGAGTATCTTGACGATACTCGAGTATCGTCAAGATACTCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-1971s21c1
Sequence:CCGGGAAGACCCTGGTGGAGTATTTCTCGAGAAATACTCCACCAGGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002180.2-3384s21c1
Sequence:CCGGGGTTCCAGTCCCTGGAGAATACTCGAGTATTCTCCAGGGACTGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-767s21c1
Sequence:CCGGCGACTGTGGTTGAGATCATTCCTCGAGGAATGATCTCAACCACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-792s21c1
Sequence:CCGGAGCTGTGAAACAAGGCTTAAACTCGAGTTTAAGCCTTGTTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-561s21c1
Sequence:CCGGTGCTCTAAAGAAGTATCATTCCTCGAGGAATGATACTTCTTTAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002180
VALIDATED
IGHMBP2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin mu binding protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-915s1c1
Sequence:CCGGGTGCCCAGAATGTTGCAGATACTCGAGTATCTGCAACATTCTGGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-454s21c1
Sequence:CCGGTTTGATGAGTCCCACGATTTCCTCGAGGAAATCGTGGGACTCATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-633s1c1
Sequence:CCGGCCCAGAAAGAAGCGGTTTCATCTCGAGATGAAACCGCTTCTTTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-399s1c1
Sequence:CCGGCCTTTGATGAGTCCCACGATTCTCGAGAATCGTGGGACTCATCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002180.1-292s1c1
Sequence:CCGGCAGCTTTACTTCTGGTGATATCTCGAGATATCACCAGAAGTAAAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002180.1-1965s1c1
Sequence:CCGGCCTTTGAGTATCTTGACGATACTCGAGTATCGTCAAGATACTCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-1971s21c1
Sequence:CCGGGAAGACCCTGGTGGAGTATTTCTCGAGAAATACTCCACCAGGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002180.2-3384s21c1
Sequence:CCGGGGTTCCAGTCCCTGGAGAATACTCGAGTATTCTCCAGGGACTGGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-767s21c1
Sequence:CCGGCGACTGTGGTTGAGATCATTCCTCGAGGAATGATCTCAACCACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-792s21c1
Sequence:CCGGAGCTGTGAAACAAGGCTTAAACTCGAGTTTAAGCCTTGTTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002180.2-561s21c1
Sequence:CCGGTGCTCTAAAGAAGTATCATTCCTCGAGGAATGATACTTCTTTAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)