EMAIL THIS PAGE TO A FRIEND

IGIP

IgA-inducing protein

19 Gene Product Result for
Synonyms: C5orf53
UniProtKB ID: A6NJ69
Gene ID:
Mouse(109169) IgA inducing protein
Rat(100363266) IgA-inducing protein homolog (Bos taurus)
cow(404059) IgA regulatory protein
domestic cat(101092824) IgA-inducing protein homolog (Bos taurus)
dog(100683020) IgA-inducing protein homolog (Bos taurus)
sheep(101117329) IgA-inducing protein homolog (Bos taurus)
domestic guinea pig(100733632) IgA-inducing protein homolog (Bos taurus)
naked mole-rat(101698181) IgA-inducing protein homolog (Bos taurus)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007189 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007189 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226879 predicted 2576
2 SASI_Hs01_00226880 predicted 2536
3 SASI_Hs01_00226881 predicted 2572
4 SASI_Hs01_00226882 predicted 2574
5 SASI_Hs01_00226883 predicted 2622
6 SASI_Hs02_00305248 predicted 2576
7 SASI_Hs01_00226884 predicted 2591
8 SASI_Hs01_00226885 predicted 2564
9 SASI_Hs01_00226886 predicted 2573
10 SASI_Hs01_00226887 predicted 2647
11 SASI_Hs01_00226888 predicted 2649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007189
IGIP MISSION shRNA Bacterial Glycerol Stock
IgA-inducing protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2543s21c1
Sequence:CCGGTGTGCAGTTATTATCACATGACTCGAGTCATGTGATAATAACTGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2579s21c1
Sequence:CCGGCGGGCTGTAATATTACCATATCTCGAGATATGGTAATATTACAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2602s21c1
Sequence:CCGGGCTGTCATGTTCTCCCATCTCCTCGAGGAGATGGGAGAACATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2636s1c1
Sequence:CCGGCACCATGTGGAAACCAAGCAACTCGAGTTGCTTGGTTTCCACATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2676s1c1
Sequence:CCGGGCTTGAGTTTGTTCAATATCACTCGAGTGATATTGAACAAACTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007189.1-2719s1c1
Sequence:CCGGGCTGTACTGCTTATTGAAGTACTCGAGTACTTCAATAAGCAGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2649s1c1
Sequence:CCGGCCAAGCAAACGTGTTGTGCATCTCGAGATGCACAACACGTTTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2642s1c1
Sequence:CCGGGTGGAAACCAAGCAAACGTGTCTCGAGACACGTTTGCTTGGTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2631s1c1
Sequence:CCGGGAAATCACCATGTGGAAACCACTCGAGTGGTTTCCACATGGTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2605s1c1
Sequence:CCGGGTCATGTTCTCCCATCTCAGTCTCGAGACTGAGATGGGAGAACATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007189
IGIP MISSION shRNA shRNA Plasmid DNA
IgA-inducing protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2543s21c1
Sequence:CCGGTGTGCAGTTATTATCACATGACTCGAGTCATGTGATAATAACTGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2579s21c1
Sequence:CCGGCGGGCTGTAATATTACCATATCTCGAGATATGGTAATATTACAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2602s21c1
Sequence:CCGGGCTGTCATGTTCTCCCATCTCCTCGAGGAGATGGGAGAACATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2636s1c1
Sequence:CCGGCACCATGTGGAAACCAAGCAACTCGAGTTGCTTGGTTTCCACATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2676s1c1
Sequence:CCGGGCTTGAGTTTGTTCAATATCACTCGAGTGATATTGAACAAACTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007189.1-2719s1c1
Sequence:CCGGGCTGTACTGCTTATTGAAGTACTCGAGTACTTCAATAAGCAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2649s1c1
Sequence:CCGGCCAAGCAAACGTGTTGTGCATCTCGAGATGCACAACACGTTTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2642s1c1
Sequence:CCGGGTGGAAACCAAGCAAACGTGTCTCGAGACACGTTTGCTTGGTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2631s1c1
Sequence:CCGGGAAATCACCATGTGGAAACCACTCGAGTGGTTTCCACATGGTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2605s1c1
Sequence:CCGGGTCATGTTCTCCCATCTCAGTCTCGAGACTGAGATGGGAGAACATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007189
IGIP MISSION shRNA Lentiviral Transduction Particles
IgA-inducing protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2543s21c1
Sequence:CCGGTGTGCAGTTATTATCACATGACTCGAGTCATGTGATAATAACTGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2579s21c1
Sequence:CCGGCGGGCTGTAATATTACCATATCTCGAGATATGGTAATATTACAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007189.1-2602s21c1
Sequence:CCGGGCTGTCATGTTCTCCCATCTCCTCGAGGAGATGGGAGAACATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2636s1c1
Sequence:CCGGCACCATGTGGAAACCAAGCAACTCGAGTTGCTTGGTTTCCACATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2676s1c1
Sequence:CCGGGCTTGAGTTTGTTCAATATCACTCGAGTGATATTGAACAAACTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161864    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007189.1-2719s1c1
Sequence:CCGGGCTGTACTGCTTATTGAAGTACTCGAGTACTTCAATAAGCAGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2649s1c1
Sequence:CCGGCCAAGCAAACGTGTTGTGCATCTCGAGATGCACAACACGTTTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2642s1c1
Sequence:CCGGGTGGAAACCAAGCAAACGTGTCTCGAGACACGTTTGCTTGGTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2631s1c1
Sequence:CCGGGAAATCACCATGTGGAAACCACTCGAGTGGTTTCCACATGGTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007189.1-2605s1c1
Sequence:CCGGGTCATGTTCTCCCATCTCAGTCTCGAGACTGAGATGGGAGAACATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)