EMAIL THIS PAGE TO A FRIEND

IGLL3P

immunoglobulin lambda-like polypeptide 3, pseudogene

12 Gene Product Result for
Synonyms: 16.1 IGLL3
Species: Human IGLL3P(91353)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013618 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013618 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089980 predicted 286
2 SASI_Hs01_00089981 predicted 540
3 SASI_Hs01_00089982 predicted 541
4 SASI_Hs01_00089983 predicted 213
5 SASI_Hs01_00089987 predicted 641
6 SASI_Hs01_00089984 predicted 278
7 SASI_Hs01_00089985 predicted 281
8 SASI_Hs01_00089986 predicted 399
9 SASI_Hs01_00089988 predicted 633
10 SASI_Hs01_00089989 predicted 142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013618
IGLL3P MISSION shRNA Bacterial Glycerol Stock
immunoglobulin lambda-like polypeptide 3, pseudogene
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-219s1c1
Sequence:CCGGCAGATAGAGAACAGGCACAGACTCGAGTCTGTGCCTGTTCTCTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-631s1c1
Sequence:CCGGCAAACAGAGCAACAGCAAGTACTCGAGTACTTGCTGTTGCTCTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-403s1c1
Sequence:CCGGGCATAATTCAGTGAAGCATGTCTCGAGACATGCTTCACTGAATTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-544s1c1
Sequence:CCGGGAATGACTTCTATCTGGGAATCTCGAGATTCCCAGATAGAAGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-526s1c1
Sequence:CCGGCACACTGGTGTGTCTCATGAACTCGAGTTCATGAGACACACCAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-217s1c1
Sequence:CCGGCTCAGATAGAGAACAGGCACACTCGAGTGTGCCTGTTCTCTATCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-411s1c1
Sequence:CCGGCAGTGAAGCATGTGTTTGGCACTCGAGTGCCAAACACATGCTTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-221s1c1
Sequence:CCGGGATAGAGAACAGGCACAGAGACTCGAGTCTCTGTGCCTGTTCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013618
IGLL3P MISSION shRNA shRNA Plasmid DNA
immunoglobulin lambda-like polypeptide 3, pseudogene
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-219s1c1
Sequence:CCGGCAGATAGAGAACAGGCACAGACTCGAGTCTGTGCCTGTTCTCTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-631s1c1
Sequence:CCGGCAAACAGAGCAACAGCAAGTACTCGAGTACTTGCTGTTGCTCTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-403s1c1
Sequence:CCGGGCATAATTCAGTGAAGCATGTCTCGAGACATGCTTCACTGAATTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-544s1c1
Sequence:CCGGGAATGACTTCTATCTGGGAATCTCGAGATTCCCAGATAGAAGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-526s1c1
Sequence:CCGGCACACTGGTGTGTCTCATGAACTCGAGTTCATGAGACACACCAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-217s1c1
Sequence:CCGGCTCAGATAGAGAACAGGCACACTCGAGTGTGCCTGTTCTCTATCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-411s1c1
Sequence:CCGGCAGTGAAGCATGTGTTTGGCACTCGAGTGCCAAACACATGCTTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-221s1c1
Sequence:CCGGGATAGAGAACAGGCACAGAGACTCGAGTCTCTGTGCCTGTTCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013618
IGLL3P MISSION shRNA Lentiviral Transduction Particles
immunoglobulin lambda-like polypeptide 3, pseudogene
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-219s1c1
Sequence:CCGGCAGATAGAGAACAGGCACAGACTCGAGTCTGTGCCTGTTCTCTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-631s1c1
Sequence:CCGGCAAACAGAGCAACAGCAAGTACTCGAGTACTTGCTGTTGCTCTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-403s1c1
Sequence:CCGGGCATAATTCAGTGAAGCATGTCTCGAGACATGCTTCACTGAATTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-544s1c1
Sequence:CCGGGAATGACTTCTATCTGGGAATCTCGAGATTCCCAGATAGAAGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013618.1-526s1c1
Sequence:CCGGCACACTGGTGTGTCTCATGAACTCGAGTTCATGAGACACACCAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-217s1c1
Sequence:CCGGCTCAGATAGAGAACAGGCACACTCGAGTGTGCCTGTTCTCTATCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-411s1c1
Sequence:CCGGCAGTGAAGCATGTGTTTGGCACTCGAGTGCCAAACACATGCTTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013618.1-221s1c1
Sequence:CCGGGATAGAGAACAGGCACAGAGACTCGAGTCTCTGTGCCTGTTCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)