EMAIL THIS PAGE TO A FRIEND

IGLON5

IgLON family member 5

81 Gene Product Result for
UniProtKB ID: A6NGN9
Gene ID:
Mouse(210094) IgLON family member 5
Rat(308557) IgLON family member 5
domestic guinea pig(100715295) IgLON family member 5
naked mole-rat(101711891) IgLON family member 5
sheep(101121878) IgLON family member 5
dog(611744) IgLON family member 5
cow(786369) IgLON family member 5
domestic cat(101095454) IgLON family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101372 Rosetta Predictions human pricing
XM_380008 Rosetta Predictions human pricing
XM_001080349 Rosetta Predictions rat pricing
XM_218634 Rosetta Predictions rat pricing
XM_001474467 Rosetta Predictions mouse pricing
XM_357746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322725 predicted 819
2 SASI_Hs02_00322726 predicted 843
3 SASI_Hs02_00322727 predicted 783
4 SASI_Hs02_00322728 predicted 514
5 SASI_Hs02_00322729 predicted 314
6 SASI_Hs02_00322730 predicted 835
7 SASI_Hs02_00322731 predicted 732
8 SASI_Hs02_00322732 predicted 269
9 SASI_Hs02_00322733 predicted 1171
10 SASI_Hs02_00322734 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_380008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285735 predicted 853
2 SASI_Hs01_00285736 predicted 879
3 SASI_Hs01_00285737 predicted 826
4 SASI_Hs01_00285738 predicted 872
5 SASI_Hs01_00285739 predicted 240
6 SASI_Hs01_00285740 predicted 261
7 SASI_Hs01_00285741 predicted 1210
8 SASI_Hs01_00285742 predicted 1211
9 SASI_Hs01_00285743 predicted 1216
10 SASI_Hs01_00285744 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367682 predicted 331
2 SASI_Rn02_00367683 predicted 728
3 SASI_Rn02_00367684 predicted 766
4 SASI_Rn02_00367685 predicted 321
5 SASI_Rn02_00367686 predicted 678
6 SASI_Rn02_00367687 predicted 259
7 SASI_Rn02_00367688 predicted 466
8 SASI_Rn02_00367689 predicted 359
9 SASI_Rn02_00367690 predicted 519
10 SASI_Rn02_00367691 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377903 predicted 404
2 SASI_Rn02_00377904 predicted 1187
3 SASI_Rn02_00377905 predicted 1229
4 SASI_Rn02_00377906 predicted 809
5 SASI_Rn02_00377907 predicted 1244
6 SASI_Rn02_00377908 predicted 1184
7 SASI_Rn02_00377909 predicted 841
8 SASI_Rn02_00377910 predicted 1519
9 SASI_Rn02_00377911 predicted 1497
10 SASI_Rn02_00377912 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00375534 predicted 386
2 SASI_Mm02_00375535 predicted 786
3 SASI_Mm02_00375536 predicted 379
4 SASI_Mm02_00375537 predicted 579
5 SASI_Mm02_00375538 predicted 815
6 SASI_Mm02_00375539 predicted 362
7 SASI_Mm02_00375540 predicted 620
8 SASI_Mm02_00375541 predicted 357
9 SASI_Mm02_00375542 predicted 492
10 SASI_Mm02_00375543 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426164 predicted 386
2 SASI_Mm02_00426165 predicted 781
3 SASI_Mm02_00426166 predicted 381
4 SASI_Mm02_00426167 predicted 582
5 SASI_Mm02_00426168 predicted 815
6 SASI_Mm02_00426169 predicted 362
7 SASI_Mm02_00426170 predicted 616
8 SASI_Mm02_00426171 predicted 351
9 SASI_Mm02_00426172 predicted 492
10 SASI_Mm02_00426173 predicted 354
11 SASI_Mm01_00284546 predicted 920
12 SASI_Mm01_00284547 predicted 894
13 SASI_Mm01_00284548 predicted 924
14 SASI_Mm01_00284549 predicted 933
15 SASI_Mm01_00284550 predicted 899
16 SASI_Mm01_00284551 predicted 922
17 SASI_Mm01_00284552 predicted 938
18 SASI_Mm01_00284553 predicted 922
19 SASI_Mm01_00284554 predicted 1478
20 SASI_Mm01_00284555 predicted 1510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164518
IGLON5 MISSION shRNA Bacterial Glycerol Stock
IgLON family member 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1511s21c1
Sequence:CCGGAGCTTTCCACCTTCCCATATACTCGAGTATATGGGAAGGTGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-576s21c1
Sequence:CCGGATACGAATGCGTTACTCACAACTCGAGTTGTGAGTAACGCATTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-736s21c1
Sequence:CCGGGCAGATTTCCAGTGGTACAAGCTCGAGCTTGTACCACTGGAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-372s21c1
Sequence:CCGGGGTCTACCTCATCGTCCATGTCTCGAGACATGGACGATGAGGTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-263s21c1
Sequence:CCGGTCATCAACACACCCGAGGAATCTCGAGATTCCTCGGGTGTGTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1169s21c1
Sequence:CCGGCCCATCACTGTGAGGGATTATCTCGAGATAATCCCTCACAGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-110s21c1
Sequence:CCGGCACCTGCGGACAACTATACAGCTCGAGCTGTATAGTTGTCCGCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTGAATTATCCTCGAGGATAATTCACTGTGACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164518
IGLON5 MISSION shRNA shRNA Plasmid DNA
IgLON family member 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1511s21c1
Sequence:CCGGAGCTTTCCACCTTCCCATATACTCGAGTATATGGGAAGGTGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-576s21c1
Sequence:CCGGATACGAATGCGTTACTCACAACTCGAGTTGTGAGTAACGCATTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-736s21c1
Sequence:CCGGGCAGATTTCCAGTGGTACAAGCTCGAGCTTGTACCACTGGAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-372s21c1
Sequence:CCGGGGTCTACCTCATCGTCCATGTCTCGAGACATGGACGATGAGGTAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-263s21c1
Sequence:CCGGTCATCAACACACCCGAGGAATCTCGAGATTCCTCGGGTGTGTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1169s21c1
Sequence:CCGGCCCATCACTGTGAGGGATTATCTCGAGATAATCCCTCACAGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-110s21c1
Sequence:CCGGCACCTGCGGACAACTATACAGCTCGAGCTGTATAGTTGTCCGCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTGAATTATCCTCGAGGATAATTCACTGTGACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164518
IGLON5 MISSION shRNA Lentiviral Transduction Particles
IgLON family member 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1511s21c1
Sequence:CCGGAGCTTTCCACCTTCCCATATACTCGAGTATATGGGAAGGTGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-576s21c1
Sequence:CCGGATACGAATGCGTTACTCACAACTCGAGTTGTGAGTAACGCATTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-736s21c1
Sequence:CCGGGCAGATTTCCAGTGGTACAAGCTCGAGCTTGTACCACTGGAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-372s21c1
Sequence:CCGGGGTCTACCTCATCGTCCATGTCTCGAGACATGGACGATGAGGTAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-263s21c1
Sequence:CCGGTCATCAACACACCCGAGGAATCTCGAGATTCCTCGGGTGTGTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164518.1-1169s21c1
Sequence:CCGGCCCATCACTGTGAGGGATTATCTCGAGATAATCCCTCACAGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-110s21c1
Sequence:CCGGCACCTGCGGACAACTATACAGCTCGAGCTGTATAGTTGTCCGCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164518.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTGAATTATCCTCGAGGATAATTCACTGTGACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101372
IGLON5 MISSION shRNA Bacterial Glycerol Stock
IgLON family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-200s21c1
Sequence:CCGGACCGCTCCAACATCCTGTATGCTCGAGCATACAGGATGTTGGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-848s21c1
Sequence:CCGGCCCGGCATTACGGCAACTATACTCGAGTATAGTTGCCGTAATGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101372.1-2344s21c1
Sequence:CCGGTCCCAGGAGACCCTCTATATACTCGAGTATATAGAGGGTCTCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTCAACTATCCTCGAGGATAGTTGACTGTGACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-104s21c1
Sequence:CCGGTCAACTCTCCTGCCGACAACTCTCGAGAGTTGTCGGCAGGAGAGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101372
IGLON5 MISSION shRNA shRNA Plasmid DNA
IgLON family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-200s21c1
Sequence:CCGGACCGCTCCAACATCCTGTATGCTCGAGCATACAGGATGTTGGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-848s21c1
Sequence:CCGGCCCGGCATTACGGCAACTATACTCGAGTATAGTTGCCGTAATGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101372.1-2344s21c1
Sequence:CCGGTCCCAGGAGACCCTCTATATACTCGAGTATATAGAGGGTCTCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTCAACTATCCTCGAGGATAGTTGACTGTGACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-104s21c1
Sequence:CCGGTCAACTCTCCTGCCGACAACTCTCGAGAGTTGTCGGCAGGAGAGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101372
IGLON5 MISSION shRNA Lentiviral Transduction Particles
IgLON family member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-200s21c1
Sequence:CCGGACCGCTCCAACATCCTGTATGCTCGAGCATACAGGATGTTGGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-848s21c1
Sequence:CCGGCCCGGCATTACGGCAACTATACTCGAGTATAGTTGCCGTAATGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101372.1-2344s21c1
Sequence:CCGGTCCCAGGAGACCCTCTATATACTCGAGTATATAGAGGGTCTCCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-629s21c1
Sequence:CCGGTGCTGGTCACAGTCAACTATCCTCGAGGATAGTTGACTGTGACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101372.1-104s21c1
Sequence:CCGGTCAACTCTCCTGCCGACAACTCTCGAGAGTTGTCGGCAGGAGAGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)