EMAIL THIS PAGE TO A FRIEND

IGSF10

immunoglobulin superfamily, member 10

59 Gene Product Result for
Synonyms: CMF608
UniProtKB ID: Q6WRI0, Q86YJ9, Q8N772, Q8NA84
Gene ID:
Mouse(242050) immunoglobulin superfamily, member 10
Rat(310448) immunoglobulin superfamily, member 10
domestic guinea pig(100721088) immunoglobulin superfamily, member 10
naked mole-rat(101700938) immunoglobulin superfamily, member 10
sheep(101116950) immunoglobulin superfamily, member 10
Domestic Rabbit(100345517) immunoglobulin superfamily, member 10
chicken(425035) immunoglobulin superfamily, member 10
domestic cat(101092637) immunoglobulin superfamily, member 10
cow(537487) immunoglobulin superfamily, member 10
Horse(100056768) immunoglobulin superfamily, member 10
dog(477114) immunoglobulin superfamily, member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178822 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178822 Rosetta Predictions human pricing
NM_198768 Rosetta Predictions rat pricing
XM_887155 Rosetta Predictions mouse pricing
XM_913941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233491 predicted 598
2 SASI_Hs01_00233492 predicted 5477
3 SASI_Hs01_00233494 predicted 2820
4 SASI_Hs01_00233495 predicted 4764
5 SASI_Hs01_00233496 predicted 5155
6 SASI_Hs01_00233497 predicted 6612
7 SASI_Hs01_00233498 predicted 7456
8 SASI_Hs01_00233499 predicted 1695
9 SASI_Hs01_00233500 predicted 6237
10 SASI_Hs02_00369867 predicted 3058
11 SASI_Hs01_00233493 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051504 predicted 1434
2 SASI_Rn01_00051505 predicted 927
3 SASI_Rn01_00051507 predicted 3348
4 SASI_Rn01_00051508 predicted 6653
5 SASI_Rn01_00051509 predicted 7790
6 SASI_Rn01_00051511 predicted 7047
7 SASI_Rn01_00051512 predicted 8310
8 SASI_Rn01_00051513 predicted 5405
9 SASI_Rn02_00270013 predicted 7212
10 SASI_Rn02_00270014 predicted 7608
11 SASI_Rn01_00051506 predicted 4845
12 SASI_Rn01_00051510 predicted 5406
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278871 predicted 1094
2 SASI_Mm02_00428480 predicted 5001
3 SASI_Mm01_00278872 predicted 3337
4 SASI_Mm02_00428481 predicted 7653
5 SASI_Mm02_00428482 predicted 7737
6 SASI_Mm01_00278874 predicted 6398
7 SASI_Mm01_00278876 predicted 4472
8 SASI_Mm01_00278877 predicted 1900
9 SASI_Mm01_00278878 predicted 1607
10 SASI_Mm01_00278879 predicted 1806
11 SASI_Mm01_00278873 predicted 3894
12 SASI_Mm01_00278875 predicted 4825
13 SASI_Mm01_00278880 predicted 5152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438144 predicted 1094
2 SASI_Mm02_00438145 predicted 5003
3 SASI_Mm02_00438146 predicted 3336
4 SASI_Mm02_00438147 predicted 7652
5 SASI_Mm02_00438148 predicted 7735
6 SASI_Mm02_00438149 predicted 6403
7 SASI_Mm02_00438150 predicted 4466
8 SASI_Mm02_00438151 predicted 1903
9 SASI_Mm02_00438152 predicted 1607
10 SASI_Mm02_00438153 predicted 1811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178822
IGSF10 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-1637s1c1
Sequence:CCGGCAGGCGTATATCACTGTATAACTCGAGTTATACAGTGATATACGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-2849s1c1
Sequence:CCGGCCACAAATAGTCATCAGACATCTCGAGATGTCTGATGACTATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-7331s1c1
Sequence:CCGGGCATCAGTGGAGAATCTCTATCTCGAGATAGAGATTCTCCACTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-5521s1c1
Sequence:CCGGCCACCTGTTATTCTAGAGCAACTCGAGTTGCTCTAGAATAACAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-170s1c1
Sequence:CCGGCCAATGTGGAACGCATCAATTCTCGAGAATTGATGCGTTCCACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-169s1c1
Sequence:CCGGCCCAATGTGGAACGCATCAATCTCGAGATTGATGCGTTCCACATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-6912s1c1
Sequence:CCGGGCTTTCAGATTCAGCCGACTTCTCGAGAAGTCGGCTGAATCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178822.3-7240s21c1
Sequence:CCGGAGGAATAAAGTTGGCTATATTCTCGAGAATATAGCCAACTTTATTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178822
IGSF10 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-1637s1c1
Sequence:CCGGCAGGCGTATATCACTGTATAACTCGAGTTATACAGTGATATACGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-2849s1c1
Sequence:CCGGCCACAAATAGTCATCAGACATCTCGAGATGTCTGATGACTATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-7331s1c1
Sequence:CCGGGCATCAGTGGAGAATCTCTATCTCGAGATAGAGATTCTCCACTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-5521s1c1
Sequence:CCGGCCACCTGTTATTCTAGAGCAACTCGAGTTGCTCTAGAATAACAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-170s1c1
Sequence:CCGGCCAATGTGGAACGCATCAATTCTCGAGAATTGATGCGTTCCACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-169s1c1
Sequence:CCGGCCCAATGTGGAACGCATCAATCTCGAGATTGATGCGTTCCACATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-6912s1c1
Sequence:CCGGGCTTTCAGATTCAGCCGACTTCTCGAGAAGTCGGCTGAATCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178822.3-7240s21c1
Sequence:CCGGAGGAATAAAGTTGGCTATATTCTCGAGAATATAGCCAACTTTATTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178822
IGSF10 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-1637s1c1
Sequence:CCGGCAGGCGTATATCACTGTATAACTCGAGTTATACAGTGATATACGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-2849s1c1
Sequence:CCGGCCACAAATAGTCATCAGACATCTCGAGATGTCTGATGACTATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-7331s1c1
Sequence:CCGGGCATCAGTGGAGAATCTCTATCTCGAGATAGAGATTCTCCACTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-5521s1c1
Sequence:CCGGCCACCTGTTATTCTAGAGCAACTCGAGTTGCTCTAGAATAACAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-170s1c1
Sequence:CCGGCCAATGTGGAACGCATCAATTCTCGAGAATTGATGCGTTCCACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178822.3-169s1c1
Sequence:CCGGCCCAATGTGGAACGCATCAATCTCGAGATTGATGCGTTCCACATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178822.3-6912s1c1
Sequence:CCGGGCTTTCAGATTCAGCCGACTTCTCGAGAAGTCGGCTGAATCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178822.3-7240s21c1
Sequence:CCGGAGGAATAAAGTTGGCTATATTCTCGAGAATATAGCCAACTTTATTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)