EMAIL THIS PAGE TO A FRIEND

IGSF11

immunoglobulin superfamily, member 11

179 Gene Product Result for
Synonyms: BT-IgSF CT119 CXADRL1 Igsf13 VSIG3
UniProtKB ID: Q5DX21, C9JZN0, Q8N4F1, Q8N7T8, Q8NDD2
Gene ID:
Human(152404) Summary: IGSF11 is an immunoglobulin (Ig) superfamily member that is preferentially expressed in brain and testis. It shares significant homology with coxsackievirus and adenovirus receptor (CXADR; MIM 602621) and endothelial cell-selective adhesion molecule (ESAM).[supplied by OMIM, Apr 2005]
Mouse(207683) immunoglobulin superfamily, member 11
Rat(303926) immunoglobulin superfamily, member 11
Zebrafish(100004469) immunoglobulin superfamily member 11
cow(540003) immunoglobulin superfamily, member 11
Horse(100071118) immunoglobulin superfamily, member 11
domestic cat(101087598) immunoglobulin superfamily, member 11
dog(487989) immunoglobulin superfamily, member 11
chicken(418346) immunoglobulin superfamily, member 11
sheep(101104446) immunoglobulin superfamily, member 11
domestic guinea pig(100734994) immunoglobulin superfamily, member 11
naked mole-rat(101708934) immunoglobulin superfamily, member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_170599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015887 Rosetta Predictions human pricing
NM_152538 Rosetta Predictions human pricing
NM_001013120 Rosetta Predictions rat pricing
XM_001069103 Rosetta Predictions rat pricing
NM_170599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227039 predicted 1304
2 SASI_Hs01_00227040 predicted 1260
3 SASI_Hs01_00227042 predicted 792
4 SASI_Hs01_00227044 predicted 536
5 SASI_Hs02_00306674 predicted 1624
6 SASI_Hs01_00227046 predicted 1632
7 SASI_Hs01_00227047 predicted 1167
8 SASI_Hs02_00306675 predicted 887
9 SASI_Hs01_00227048 predicted 1481
10 SASI_Hs02_00306676 predicted 1148
11 SASI_Hs01_00227041 predicted 1625
12 SASI_Hs01_00227043 predicted 769
13 SASI_Hs01_00227045 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021320 predicted 1435
2 SASI_Hs01_00021321 predicted 1384
3 SASI_Hs01_00021323 predicted 928
4 SASI_Hs01_00021325 predicted 669
5 SASI_Hs02_00366336 predicted 1756
6 SASI_Hs01_00021327 predicted 1764
7 SASI_Hs01_00021328 predicted 1304
8 SASI_Hs02_00366337 predicted 1017
9 SASI_Hs01_00021329 predicted 1614
10 SASI_Hs02_00366338 predicted 1273
11 SASI_Hs01_00021322 predicted 1750
12 SASI_Hs01_00021324 predicted 897
13 SASI_Hs01_00021326 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200828 predicted 1116
2 SASI_Rn01_00088758 predicted 1204
3 SASI_Rn01_00088759 predicted 1569
4 SASI_Rn01_00088761 predicted 1046
5 SASI_Rn01_00088762 predicted 706
6 SASI_Rn01_00088763 predicted 1229
7 SASI_Rn01_00088764 predicted 1186
8 SASI_Rn01_00088765 predicted 945
9 SASI_Rn01_00088766 predicted 525
10 SASI_Rn01_00088767 predicted 1146
11 SASI_Rn01_00088760 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326912 predicted 1219
2 SASI_Rn02_00326913 predicted 1141
3 SASI_Rn02_00326914 predicted 880
4 SASI_Rn02_00326915 predicted 1308
5 SASI_Rn02_00326916 predicted 444
6 SASI_Rn02_00326917 predicted 1290
7 SASI_Rn02_00326918 predicted 640
8 SASI_Rn02_00326919 predicted 771
9 SASI_Rn02_00326920 predicted 1312
10 SASI_Rn02_00326921 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149931 predicted 1170
2 SASI_Mm01_00149932 predicted 459
3 SASI_Mm01_00149933 predicted 917
4 SASI_Mm01_00149934 predicted 1065
5 SASI_Mm02_00343560 predicted 996
6 SASI_Mm01_00149935 predicted 1340
7 SASI_Mm01_00149936 predicted 1141
8 SASI_Mm01_00149938 predicted 1346
9 SASI_Mm01_00149939 predicted 1438
10 SASI_Mm01_00149940 predicted 1151
11 SASI_Mm01_00149937 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152538
IGSF11 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1119s21c1
Sequence:CCGGTGGCACTGGTGCAGTTATTATCTCGAGATAATAACTGCACCAGTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1473s1c1
Sequence:CCGGGAGGAAATGTTGTGTTCAGAACTCGAGTTCTGAACACAACATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1544s1c1
Sequence:CCGGCTGGGAAAGAAACACTTCCTTCTCGAGAAGGAAGTGTTTCTTTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-2125s21c1
Sequence:CCGGTCGTTATATAGAGGGCTTAATCTCGAGATTAAGCCCTCTATATAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1432s21c1
Sequence:CCGGGCCAACATACCATCCATTTATCTCGAGATAAATGGATGGTATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-1985s21c1
Sequence:CCGGTGTTCTTCATGCCTAACTTAACTCGAGTTAAGTTAGGCATGAAGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-879s1c1
Sequence:CCGGGCCCAGGAACATTGGACTAATCTCGAGATTAGTCCAATGTTCCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-379s1c1
Sequence:CCGGCCTGAACAGGTCATCCTGTATCTCGAGATACAGGATGACCTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1601s21c1
Sequence:CCGGACGCAACACTGGAACGAATTGCTCGAGCAATTCGTTCCAGTGTTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-215s1c1
Sequence:CCGGCTAGAACTGGTGTTGCAGCATCTCGAGATGCTGCAACACCAGTTCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-400s1c1
Sequence:CCGGCAGGGTGGACAGATGTTTGATCTCGAGATCAAACATCTGTCCACCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152538
IGSF11 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1119s21c1
Sequence:CCGGTGGCACTGGTGCAGTTATTATCTCGAGATAATAACTGCACCAGTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1473s1c1
Sequence:CCGGGAGGAAATGTTGTGTTCAGAACTCGAGTTCTGAACACAACATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1544s1c1
Sequence:CCGGCTGGGAAAGAAACACTTCCTTCTCGAGAAGGAAGTGTTTCTTTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-2125s21c1
Sequence:CCGGTCGTTATATAGAGGGCTTAATCTCGAGATTAAGCCCTCTATATAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1432s21c1
Sequence:CCGGGCCAACATACCATCCATTTATCTCGAGATAAATGGATGGTATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-1985s21c1
Sequence:CCGGTGTTCTTCATGCCTAACTTAACTCGAGTTAAGTTAGGCATGAAGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-879s1c1
Sequence:CCGGGCCCAGGAACATTGGACTAATCTCGAGATTAGTCCAATGTTCCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-379s1c1
Sequence:CCGGCCTGAACAGGTCATCCTGTATCTCGAGATACAGGATGACCTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1601s21c1
Sequence:CCGGACGCAACACTGGAACGAATTGCTCGAGCAATTCGTTCCAGTGTTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-215s1c1
Sequence:CCGGCTAGAACTGGTGTTGCAGCATCTCGAGATGCTGCAACACCAGTTCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-400s1c1
Sequence:CCGGCAGGGTGGACAGATGTTTGATCTCGAGATCAAACATCTGTCCACCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152538
IGSF11 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1119s21c1
Sequence:CCGGTGGCACTGGTGCAGTTATTATCTCGAGATAATAACTGCACCAGTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1473s1c1
Sequence:CCGGGAGGAAATGTTGTGTTCAGAACTCGAGTTCTGAACACAACATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152538.1-1544s1c1
Sequence:CCGGCTGGGAAAGAAACACTTCCTTCTCGAGAAGGAAGTGTTTCTTTCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-2125s21c1
Sequence:CCGGTCGTTATATAGAGGGCTTAATCTCGAGATTAAGCCCTCTATATAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1432s21c1
Sequence:CCGGGCCAACATACCATCCATTTATCTCGAGATAAATGGATGGTATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152538.2-1985s21c1
Sequence:CCGGTGTTCTTCATGCCTAACTTAACTCGAGTTAAGTTAGGCATGAAGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-879s1c1
Sequence:CCGGGCCCAGGAACATTGGACTAATCTCGAGATTAGTCCAATGTTCCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-379s1c1
Sequence:CCGGCCTGAACAGGTCATCCTGTATCTCGAGATACAGGATGACCTGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152538.2-1601s21c1
Sequence:CCGGACGCAACACTGGAACGAATTGCTCGAGCAATTCGTTCCAGTGTTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-215s1c1
Sequence:CCGGCTAGAACTGGTGTTGCAGCATCTCGAGATGCTGCAACACCAGTTCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152538.1-400s1c1
Sequence:CCGGCAGGGTGGACAGATGTTTGATCTCGAGATCAAACATCTGTCCACCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170599
VALIDATED
IGSF11 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily, member 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-1203s1c1
Sequence:CCGGGCAATGCAGTTATCCCATCAACTCGAGTTGATGGGATAACTGCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-371s1c1
Sequence:CCGGCCCGAACAGGTCATTCTTTATCTCGAGATAAAGAATGACCTGTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-927s21c1
Sequence:CCGGTCATCTGCCTTGCACTAATTTCTCGAGAAATTAGTGCAAGGCAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-758s21c1
Sequence:CCGGACAGTCACCATCCGGAATATCCTCGAGGATATTCCGGATGGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-2558s21c1
Sequence:CCGGGTAGAGTTTAGTAGGTTATTACTCGAGTAATAACCTACTAAACTCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-370s21c1
Sequence:CCGGGCCCGAACAGGTCATTCTTTACTCGAGTAAAGAATGACCTGTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170599.2-426s21c1
Sequence:CCGGTCCACGGGAGGGTAGGATTTACTCGAGTAAATCCTACCCTCCCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170599
VALIDATED
IGSF11 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily, member 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-1203s1c1
Sequence:CCGGGCAATGCAGTTATCCCATCAACTCGAGTTGATGGGATAACTGCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-371s1c1
Sequence:CCGGCCCGAACAGGTCATTCTTTATCTCGAGATAAAGAATGACCTGTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-927s21c1
Sequence:CCGGTCATCTGCCTTGCACTAATTTCTCGAGAAATTAGTGCAAGGCAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-758s21c1
Sequence:CCGGACAGTCACCATCCGGAATATCCTCGAGGATATTCCGGATGGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-2558s21c1
Sequence:CCGGGTAGAGTTTAGTAGGTTATTACTCGAGTAATAACCTACTAAACTCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-370s21c1
Sequence:CCGGGCCCGAACAGGTCATTCTTTACTCGAGTAAAGAATGACCTGTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170599.2-426s21c1
Sequence:CCGGTCCACGGGAGGGTAGGATTTACTCGAGTAAATCCTACCCTCCCGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170599
VALIDATED
IGSF11 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily, member 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-1203s1c1
Sequence:CCGGGCAATGCAGTTATCCCATCAACTCGAGTTGATGGGATAACTGCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170599.2-371s1c1
Sequence:CCGGCCCGAACAGGTCATTCTTTATCTCGAGATAAAGAATGACCTGTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-927s21c1
Sequence:CCGGTCATCTGCCTTGCACTAATTTCTCGAGAAATTAGTGCAAGGCAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-758s21c1
Sequence:CCGGACAGTCACCATCCGGAATATCCTCGAGGATATTCCGGATGGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-2558s21c1
Sequence:CCGGGTAGAGTTTAGTAGGTTATTACTCGAGTAATAACCTACTAAACTCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170599.2-370s21c1
Sequence:CCGGGCCCGAACAGGTCATTCTTTACTCGAGTAAAGAATGACCTGTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170599.2-426s21c1
Sequence:CCGGTCCACGGGAGGGTAGGATTTACTCGAGTAAATCCTACCCTCCCGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)